CmoCh14G015780 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGACAACAAGAATCCCAAAATCTTGCTTTCTTCTCTTTCTCCTCCTCGTTCAAGATCTTTGTCTCGTTCGAGCTTCATCGAAGCACTCTTGCAATGGCTCCATAGCTGAGTGTGGTGGTGAAGACGAGACGTTGATGGAGTCGGAGATAAGTCGAAGGTTTCTCGCACAGCAAAAGAAATATATCTCTATTGGAGCTTTGAAAAAGGATCACCCAGCTTGTGATGGGGGTGGCGGTGGTCAACCTTACACTAAAAGCGGAAGCTGCGCTCCGCCGCCAGCAAATCCTTACAATCGAGGCTGCTCTAAGATATATCGTTGTAGGTCTGACGATTGA ATGACAACAAGAATCCCAAAATCTTGCTTTCTTCTCTTTCTCCTCCTCGTTCAAGATCTTTGTCTCGTTCGAGCTTCATCGAAGCACTCTTGCAATGGCTCCATAGCTGAGTGTGGTGGTGAAGACGAGACGTTGATGGAGTCGGAGATAAGTCGAAGGTTTCTCGCACAGCAAAAGAAATATATCTCTATTGGAGCTTTGAAAAAGGATCACCCAGCTTGTGATGGGGGTGGCGGTGGTCAACCTTACACTAAAAGCGGAAGCTGCGCTCCGCCGCCAGCAAATCCTTACAATCGAGGCTGCTCTAAGATATATCGTTGTAGGTCTGACGATTGA ATGACAACAAGAATCCCAAAATCTTGCTTTCTTCTCTTTCTCCTCCTCGTTCAAGATCTTTGTCTCGTTCGAGCTTCATCGAAGCACTCTTGCAATGGCTCCATAGCTGAGTGTGGTGGTGAAGACGAGACGTTGATGGAGTCGGAGATAAGTCGAAGGTTTCTCGCACAGCAAAAGAAATATATCTCTATTGGAGCTTTGAAAAAGGATCACCCAGCTTGTGATGGGGGTGGCGGTGGTCAACCTTACACTAAAAGCGGAAGCTGCGCTCCGCCGCCAGCAAATCCTTACAATCGAGGCTGCTCTAAGATATATCGTTGTAGGTCTGACGATTGA
BLAST of CmoCh14G015780 vs. Swiss-Prot
Match: RLF32_ARATH (Protein RALF-like 32 OS=Arabidopsis thaliana GN=RALFL32 PE=3 SV=1) HSP 1 Score: 94.0 bits (232), Expect = 1.1e-18 Identity = 52/113 (46.02%), Postives = 68/113 (60.18%), Query Frame = 1
BLAST of CmoCh14G015780 vs. Swiss-Prot
Match: RLF1_ARATH (Protein RALF-like 1 OS=Arabidopsis thaliana GN=RALF1 PE=1 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 1.7e-11 Identity = 40/79 (50.63%), Postives = 51/79 (64.56%), Query Frame = 1
BLAST of CmoCh14G015780 vs. Swiss-Prot
Match: RLF22_ARATH (Protein RALF-like 22 OS=Arabidopsis thaliana GN=RALFL22 PE=3 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 3.9e-11 Identity = 44/93 (47.31%), Postives = 55/93 (59.14%), Query Frame = 1
BLAST of CmoCh14G015780 vs. Swiss-Prot
Match: RALF_TOBAC (Rapid alkalinization factor OS=Nicotiana tabacum GN=RALF PE=1 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 8.6e-11 Identity = 42/86 (48.84%), Postives = 50/86 (58.14%), Query Frame = 1
BLAST of CmoCh14G015780 vs. Swiss-Prot
Match: RLF33_ARATH (Protein RALF-like 33 OS=Arabidopsis thaliana GN=RALFL33 PE=2 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 5.6e-10 Identity = 39/81 (48.15%), Postives = 49/81 (60.49%), Query Frame = 1
BLAST of CmoCh14G015780 vs. TrEMBL
Match: A0A0A0L9A8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G171840 PE=4 SV=1) HSP 1 Score: 187.6 bits (475), Expect = 8.3e-45 Identity = 90/109 (82.57%), Postives = 95/109 (87.16%), Query Frame = 1
BLAST of CmoCh14G015780 vs. TrEMBL
Match: A0A0A0L624_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G171850 PE=4 SV=1) HSP 1 Score: 134.0 bits (336), Expect = 1.1e-28 Identity = 71/98 (72.45%), Postives = 76/98 (77.55%), Query Frame = 1
BLAST of CmoCh14G015780 vs. TrEMBL
Match: C6T1A5_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_05G151400 PE=2 SV=1) HSP 1 Score: 132.9 bits (333), Expect = 2.4e-28 Identity = 63/103 (61.17%), Postives = 76/103 (73.79%), Query Frame = 1
BLAST of CmoCh14G015780 vs. TrEMBL
Match: B7FMN1_MEDTR (RALF OS=Medicago truncatula GN=MTR_8g083150 PE=2 SV=1) HSP 1 Score: 131.7 bits (330), Expect = 5.4e-28 Identity = 65/105 (61.90%), Postives = 77/105 (73.33%), Query Frame = 1
BLAST of CmoCh14G015780 vs. TrEMBL
Match: A0A0R0IK43_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_08G108200 PE=4 SV=1) HSP 1 Score: 131.0 bits (328), Expect = 9.2e-28 Identity = 65/112 (58.04%), Postives = 80/112 (71.43%), Query Frame = 1
BLAST of CmoCh14G015780 vs. TAIR10
Match: AT4G14010.1 (AT4G14010.1 ralf-like 32) HSP 1 Score: 94.0 bits (232), Expect = 6.3e-20 Identity = 52/113 (46.02%), Postives = 68/113 (60.18%), Query Frame = 1
BLAST of CmoCh14G015780 vs. TAIR10
Match: AT1G02900.1 (AT1G02900.1 rapid alkalinization factor 1) HSP 1 Score: 70.1 bits (170), Expect = 9.8e-13 Identity = 40/79 (50.63%), Postives = 51/79 (64.56%), Query Frame = 1
BLAST of CmoCh14G015780 vs. TAIR10
Match: AT3G05490.1 (AT3G05490.1 ralf-like 22) HSP 1 Score: 68.9 bits (167), Expect = 2.2e-12 Identity = 44/93 (47.31%), Postives = 55/93 (59.14%), Query Frame = 1
BLAST of CmoCh14G015780 vs. TAIR10
Match: AT4G15800.1 (AT4G15800.1 ralf-like 33) HSP 1 Score: 65.1 bits (157), Expect = 3.2e-11 Identity = 39/81 (48.15%), Postives = 49/81 (60.49%), Query Frame = 1
BLAST of CmoCh14G015780 vs. TAIR10
Match: AT3G16570.1 (AT3G16570.1 rapid alkalinization factor 23) HSP 1 Score: 57.4 bits (137), Expect = 6.6e-09 Identity = 39/95 (41.05%), Postives = 51/95 (53.68%), Query Frame = 1
BLAST of CmoCh14G015780 vs. NCBI nr
Match: gi|659077106|ref|XP_008439036.1| (PREDICTED: protein RALF-like 32 [Cucumis melo]) HSP 1 Score: 192.6 bits (488), Expect = 3.7e-46 Identity = 93/106 (87.74%), Postives = 96/106 (90.57%), Query Frame = 1
BLAST of CmoCh14G015780 vs. NCBI nr
Match: gi|778679218|ref|XP_004147646.2| (PREDICTED: protein RALF-like 32 [Cucumis sativus]) HSP 1 Score: 187.6 bits (475), Expect = 1.2e-44 Identity = 90/109 (82.57%), Postives = 95/109 (87.16%), Query Frame = 1
BLAST of CmoCh14G015780 vs. NCBI nr
Match: gi|700202095|gb|KGN57228.1| (hypothetical protein Csa_3G171850 [Cucumis sativus]) HSP 1 Score: 134.0 bits (336), Expect = 1.6e-28 Identity = 71/98 (72.45%), Postives = 76/98 (77.55%), Query Frame = 1
BLAST of CmoCh14G015780 vs. NCBI nr
Match: gi|351722809|ref|NP_001235977.1| (uncharacterized protein LOC100500295 precursor [Glycine max]) HSP 1 Score: 132.9 bits (333), Expect = 3.5e-28 Identity = 63/103 (61.17%), Postives = 76/103 (73.79%), Query Frame = 1
BLAST of CmoCh14G015780 vs. NCBI nr
Match: gi|357518655|ref|XP_003629616.1| (RALF [Medicago truncatula]) HSP 1 Score: 131.7 bits (330), Expect = 7.8e-28 Identity = 65/105 (61.90%), Postives = 77/105 (73.33%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|