CmoCh06G015950 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGTCGATGAGTTCTTGCAATGTCTCAATGACCGAGCATGGTTATGAAGATGAGCTGTTAGTGCAATCTGAGATGGGTAGAAGGTTTCTCGAAGAACAAAAGAAATATATCTCCATTGAAGCTTTAAAGAAGGATATGATAGCTTTTGAGGGTAGCAGCGGAGGCCAACCTTACCCCAAAAGCGAAAACTGTGCTCCCCCACCTCTTAATCCGTATAACCGAGGCTGCTCTAAAATATCTCGTTGTAGGTCTGATGATTGA ATGTCGATGAGTTCTTGCAATGTCTCAATGACCGAGCATGGTTATGAAGATGAGCTGTTAGTGCAATCTGAGATGGGTAGAAGGTTTCTCGAAGAACAAAAGAAATATATCTCCATTGAAGCTTTAAAGAAGGATATGATAGCTTTTGAGGGTAGCAGCGGAGGCCAACCTTACCCCAAAAGCGAAAACTGTGCTCCCCCACCTCTTAATCCGTATAACCGAGGCTGCTCTAAAATATCTCGTTGTAGGTCTGATGATTGA ATGTCGATGAGTTCTTGCAATGTCTCAATGACCGAGCATGGTTATGAAGATGAGCTGTTAGTGCAATCTGAGATGGGTAGAAGGTTTCTCGAAGAACAAAAGAAATATATCTCCATTGAAGCTTTAAAGAAGGATATGATAGCTTTTGAGGGTAGCAGCGGAGGCCAACCTTACCCCAAAAGCGAAAACTGTGCTCCCCCACCTCTTAATCCGTATAACCGAGGCTGCTCTAAAATATCTCGTTGTAGGTCTGATGATTGA
BLAST of CmoCh06G015950 vs. Swiss-Prot
Match: RLF32_ARATH (Protein RALF-like 32 OS=Arabidopsis thaliana GN=RALFL32 PE=3 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 5.3e-08 Identity = 35/89 (39.33%), Postives = 48/89 (53.93%), Query Frame = 1
BLAST of CmoCh06G015950 vs. TrEMBL
Match: A0A0A0L9A8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G171840 PE=4 SV=1) HSP 1 Score: 117.1 bits (292), Expect = 1.1e-23 Identity = 57/85 (67.06%), Postives = 68/85 (80.00%), Query Frame = 1
BLAST of CmoCh06G015950 vs. TrEMBL
Match: I3RZ93_LOTJA (Uncharacterized protein OS=Lotus japonicus PE=2 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 3.3e-17 Identity = 48/82 (58.54%), Postives = 58/82 (70.73%), Query Frame = 1
BLAST of CmoCh06G015950 vs. TrEMBL
Match: B7FMN1_MEDTR (RALF OS=Medicago truncatula GN=MTR_8g083150 PE=2 SV=1) HSP 1 Score: 95.1 bits (235), Expect = 4.4e-17 Identity = 48/82 (58.54%), Postives = 57/82 (69.51%), Query Frame = 1
BLAST of CmoCh06G015950 vs. TrEMBL
Match: C6T1A5_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_05G151400 PE=2 SV=1) HSP 1 Score: 92.4 bits (228), Expect = 2.8e-16 Identity = 44/82 (53.66%), Postives = 56/82 (68.29%), Query Frame = 1
BLAST of CmoCh06G015950 vs. TrEMBL
Match: A0A0S3R1D3_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.01G214200 PE=4 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 4.8e-16 Identity = 47/83 (56.63%), Postives = 56/83 (67.47%), Query Frame = 1
BLAST of CmoCh06G015950 vs. TAIR10
Match: AT4G14010.1 (AT4G14010.1 ralf-like 32) HSP 1 Score: 58.2 bits (139), Expect = 3.0e-09 Identity = 35/89 (39.33%), Postives = 48/89 (53.93%), Query Frame = 1
BLAST of CmoCh06G015950 vs. TAIR10
Match: AT4G13950.1 (AT4G13950.1 ralf-like 31) HSP 1 Score: 50.4 bits (119), Expect = 6.2e-07 Identity = 27/70 (38.57%), Postives = 39/70 (55.71%), Query Frame = 1
BLAST of CmoCh06G015950 vs. TAIR10
Match: AT3G23805.1 (AT3G23805.1 ralf-like 24) HSP 1 Score: 48.9 bits (115), Expect = 1.8e-06 Identity = 27/70 (38.57%), Postives = 39/70 (55.71%), Query Frame = 1
BLAST of CmoCh06G015950 vs. TAIR10
Match: AT1G02900.1 (AT1G02900.1 rapid alkalinization factor 1) HSP 1 Score: 48.9 bits (115), Expect = 1.8e-06 Identity = 34/81 (41.98%), Postives = 47/81 (58.02%), Query Frame = 1
BLAST of CmoCh06G015950 vs. NCBI nr
Match: gi|659077106|ref|XP_008439036.1| (PREDICTED: protein RALF-like 32 [Cucumis melo]) HSP 1 Score: 117.5 bits (293), Expect = 1.2e-23 Identity = 57/85 (67.06%), Postives = 68/85 (80.00%), Query Frame = 1
BLAST of CmoCh06G015950 vs. NCBI nr
Match: gi|778679218|ref|XP_004147646.2| (PREDICTED: protein RALF-like 32 [Cucumis sativus]) HSP 1 Score: 117.1 bits (292), Expect = 1.5e-23 Identity = 57/85 (67.06%), Postives = 68/85 (80.00%), Query Frame = 1
BLAST of CmoCh06G015950 vs. NCBI nr
Match: gi|388490538|gb|AFK33335.1| (unknown [Lotus japonicus]) HSP 1 Score: 95.5 bits (236), Expect = 4.8e-17 Identity = 48/82 (58.54%), Postives = 58/82 (70.73%), Query Frame = 1
BLAST of CmoCh06G015950 vs. NCBI nr
Match: gi|357518655|ref|XP_003629616.1| (RALF [Medicago truncatula]) HSP 1 Score: 95.1 bits (235), Expect = 6.2e-17 Identity = 48/82 (58.54%), Postives = 57/82 (69.51%), Query Frame = 1
BLAST of CmoCh06G015950 vs. NCBI nr
Match: gi|698576934|ref|XP_009776339.1| (PREDICTED: protein RALF-like 32 isoform X1 [Nicotiana sylvestris]) HSP 1 Score: 93.6 bits (231), Expect = 1.8e-16 Identity = 46/82 (56.10%), Postives = 57/82 (69.51%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|