Cp4.1LG03g05820 (gene) Cucurbita pepo (Zucchini)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCGGAGAGTGACGTGAGCGCAGCCGAGTGCGAGAGGATCTTCAAGCGATTCGACGCGAACGGCGACGGGATGATATCGGCGGCGGAGCTGGTCGATGCGTTGAACGGATTGGGAGTGAACGCGGAGGAGGCGAAGAGGATGATGGACGCGATTGACAAAGACGGCGATGGGTTCATATCGTTGGAAGAGTTCGCGGATTTCGCGAAGGATAATCGCGCGTTGATGAAAGATTTTGCAAAGGCGTTTTAA ATGGCGGAGAGTGACGTGAGCGCAGCCGAGTGCGAGAGGATCTTCAAGCGATTCGACGCGAACGGCGACGGGATGATATCGGCGGCGGAGCTGGTCGATGCGTTGAACGGATTGGGAGTGAACGCGGAGGAGGCGAAGAGGATGATGGACGCGATTGACAAAGACGGCGATGGGTTCATATCGTTGGAAGAGTTCGCGGATTTCGCGAAGGATAATCGCGCGTTGATGAAAGATTTTGCAAAGGCGTTTTAA ATGGCGGAGAGTGACGTGAGCGCAGCCGAGTGCGAGAGGATCTTCAAGCGATTCGACGCGAACGGCGACGGGATGATATCGGCGGCGGAGCTGGTCGATGCGTTGAACGGATTGGGAGTGAACGCGGAGGAGGCGAAGAGGATGATGGACGCGATTGACAAAGACGGCGATGGGTTCATATCGTTGGAAGAGTTCGCGGATTTCGCGAAGGATAATCGCGCGTTGATGAAAGATTTTGCAAAGGCGTTTTAA MAESDVSAAECERIFKRFDANGDGMISAAELVDALNGLGVNAEEAKRMMDAIDKDGDGFISLEEFADFAKDNRALMKDFAKAF
BLAST of Cp4.1LG03g05820 vs. Swiss-Prot
Match: CML28_ARATH (Probable calcium-binding protein CML28 OS=Arabidopsis thaliana GN=CML28 PE=3 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 2.9e-19 Identity = 52/76 (68.42%), Postives = 57/76 (75.00%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. Swiss-Prot
Match: POLC4_BETPN (Polcalcin Bet v 4 OS=Betula pendula GN=BETV4 PE=1 SV=1) HSP 1 Score: 94.0 bits (232), Expect = 8.4e-19 Identity = 50/76 (65.79%), Postives = 56/76 (73.68%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. Swiss-Prot
Match: POLC2_BRANA (Polcalcin Bra n 2 OS=Brassica napus PE=1 SV=1) HSP 1 Score: 94.0 bits (232), Expect = 8.4e-19 Identity = 50/76 (65.79%), Postives = 58/76 (76.32%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. Swiss-Prot
Match: POLC2_BRACM (Polcalcin Bra r 2 OS=Brassica campestris PE=1 SV=1) HSP 1 Score: 94.0 bits (232), Expect = 8.4e-19 Identity = 50/76 (65.79%), Postives = 58/76 (76.32%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. Swiss-Prot
Match: ALL3_OLEEU (Polcalcin Ole e 3 OS=Olea europaea GN=OLE3 PE=1 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 1.4e-18 Identity = 52/84 (61.90%), Postives = 59/84 (70.24%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. TrEMBL
Match: A0A0A0L775_CUCSA (Putative calcium-binding protein CML28 OS=Cucumis sativus GN=Csa_3G345360 PE=4 SV=1) HSP 1 Score: 129.8 bits (325), Expect = 1.5e-27 Identity = 65/83 (78.31%), Postives = 74/83 (89.16%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. TrEMBL
Match: A0A0B2S5H4_GLYSO (Polcalcin Nic t 1 OS=Glycine soja GN=glysoja_016839 PE=4 SV=1) HSP 1 Score: 102.8 bits (255), Expect = 2.0e-19 Identity = 55/84 (65.48%), Postives = 63/84 (75.00%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. TrEMBL
Match: I1MBX4_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_14G216000 PE=4 SV=1) HSP 1 Score: 102.8 bits (255), Expect = 2.0e-19 Identity = 55/84 (65.48%), Postives = 63/84 (75.00%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. TrEMBL
Match: V7BAK1_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_008G234700g PE=4 SV=1) HSP 1 Score: 100.5 bits (249), Expect = 1.0e-18 Identity = 54/84 (64.29%), Postives = 63/84 (75.00%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. TrEMBL
Match: G7K1Y2_MEDTR (EF hand calcium-binding family protein OS=Medicago truncatula GN=MTR_5g079470 PE=4 SV=1) HSP 1 Score: 100.1 bits (248), Expect = 1.3e-18 Identity = 54/84 (64.29%), Postives = 62/84 (73.81%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. TAIR10
Match: AT3G03430.1 (AT3G03430.1 Calcium-binding EF-hand family protein) HSP 1 Score: 95.5 bits (236), Expect = 1.6e-20 Identity = 52/76 (68.42%), Postives = 57/76 (75.00%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. TAIR10
Match: AT5G17480.1 (AT5G17480.1 pollen calcium-binding protein 1) HSP 1 Score: 92.4 bits (228), Expect = 1.4e-19 Identity = 51/76 (67.11%), Postives = 57/76 (75.00%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. TAIR10
Match: AT1G66400.1 (AT1G66400.1 calmodulin like 23) HSP 1 Score: 58.5 bits (140), Expect = 2.2e-09 Identity = 34/84 (40.48%), Postives = 46/84 (54.76%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. TAIR10
Match: AT1G73630.1 (AT1G73630.1 EF hand calcium-binding protein family) HSP 1 Score: 58.5 bits (140), Expect = 2.2e-09 Identity = 29/70 (41.43%), Postives = 45/70 (64.29%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. TAIR10
Match: AT3G17470.1 (AT3G17470.1 Ca2+-activated RelA/spot homolog) HSP 1 Score: 55.8 bits (133), Expect = 1.4e-08 Identity = 27/66 (40.91%), Postives = 39/66 (59.09%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. NCBI nr
Match: gi|659114464|ref|XP_008457063.1| (PREDICTED: polcalcin Bra n 2-like [Cucumis melo]) HSP 1 Score: 137.9 bits (346), Expect = 8.1e-30 Identity = 67/83 (80.72%), Postives = 77/83 (92.77%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. NCBI nr
Match: gi|449464146|ref|XP_004149790.1| (PREDICTED: probable calcium-binding protein CML28 [Cucumis sativus]) HSP 1 Score: 129.8 bits (325), Expect = 2.2e-27 Identity = 65/83 (78.31%), Postives = 74/83 (89.16%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. NCBI nr
Match: gi|356553301|ref|XP_003544995.1| (PREDICTED: polcalcin Nic t 1 [Glycine max]) HSP 1 Score: 102.8 bits (255), Expect = 2.9e-19 Identity = 55/84 (65.48%), Postives = 63/84 (75.00%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. NCBI nr
Match: gi|593490053|ref|XP_007141894.1| (hypothetical protein PHAVU_008G234700g [Phaseolus vulgaris]) HSP 1 Score: 100.5 bits (249), Expect = 1.4e-18 Identity = 54/84 (64.29%), Postives = 63/84 (75.00%), Query Frame = 1
BLAST of Cp4.1LG03g05820 vs. NCBI nr
Match: gi|357492167|ref|XP_003616372.1| (EF hand calcium-binding family protein [Medicago truncatula]) HSP 1 Score: 100.1 bits (248), Expect = 1.9e-18 Identity = 54/84 (64.29%), Postives = 62/84 (73.81%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita pepo
Date Performed: 2017-12-02
The following gene(s) are orthologous to this gene: The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene: None |