Cla013179 (gene) Watermelon (97103) v1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGGAGACAGTAGCGTAAGCTCAGCCGATTGCGAGAGGATTTTCAAGCGATTCGACGCTAACGGCGACGGGAAGATCTCGGCGACGGAGCTGGGCGATGCTTTGAACGGATTCGGAGTTAGTGCTGAGGACGCAAAGAGGATGATGGACGCCATTGATAAAGATGGAGATGGCTGCATTTCCTTCGAAGAGTTCGCGGATTTTGCTAAGGATAATCGCGCTTTGATGAAGGATTTTGCCAAGGCGTTTTAG ATGGGAGACAGTAGCGTAAGCTCAGCCGATTGCGAGAGGATTTTCAAGCGATTCGACGCTAACGGCGACGGGAAGATCTCGGCGACGGAGCTGGGCGATGCTTTGAACGGATTCGGAGTTAGTGCTGAGGACGCAAAGAGGATGATGGACGCCATTGATAAAGATGGAGATGGCTGCATTTCCTTCGAAGAGTTCGCGGATTTTGCTAAGGATAATCGCGCTTTGATGAAGGATTTTGCCAAGGCGTTTTAG ATGGGAGACAGTAGCGTAAGCTCAGCCGATTGCGAGAGGATTTTCAAGCGATTCGACGCTAACGGCGACGGGAAGATCTCGGCGACGGAGCTGGGCGATGCTTTGAACGGATTCGGAGTTAGTGCTGAGGACGCAAAGAGGATGATGGACGCCATTGATAAAGATGGAGATGGCTGCATTTCCTTCGAAGAGTTCGCGGATTTTGCTAAGGATAATCGCGCTTTGATGAAGGATTTTGCCAAGGCGTTTTAG MGDSSVSSADCERIFKRFDANGDGKISATELGDALNGFGVSAEDAKRMMDAIDKDGDGCISFEEFADFAKDNRALMKDFAKAF
BLAST of Cla013179 vs. Swiss-Prot
Match: POLC2_BRANA (Polcalcin Bra n 2 OS=Brassica napus PE=1 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 6.9e-21 Identity = 51/80 (63.75%), Postives = 59/80 (73.75%), Query Frame = 1
BLAST of Cla013179 vs. Swiss-Prot
Match: POLC2_BRACM (Polcalcin Bra r 2 OS=Brassica campestris PE=1 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 6.9e-21 Identity = 51/80 (63.75%), Postives = 59/80 (73.75%), Query Frame = 1
BLAST of Cla013179 vs. Swiss-Prot
Match: CML28_ARATH (Probable calcium-binding protein CML28 OS=Arabidopsis thaliana GN=CML28 PE=3 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 6.9e-21 Identity = 52/80 (65.00%), Postives = 57/80 (71.25%), Query Frame = 1
BLAST of Cla013179 vs. Swiss-Prot
Match: POLC3_CHEAL (Polcalcin Che a 3 OS=Chenopodium album PE=1 SV=1) HSP 1 Score: 98.6 bits (244), Expect = 3.4e-20 Identity = 50/82 (60.98%), Postives = 59/82 (71.95%), Query Frame = 1
BLAST of Cla013179 vs. Swiss-Prot
Match: POLC4_BETPN (Polcalcin Bet v 4 OS=Betula pendula GN=BETV4 PE=1 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 1.3e-19 Identity = 49/82 (59.76%), Postives = 56/82 (68.29%), Query Frame = 1
BLAST of Cla013179 vs. TrEMBL
Match: A0A0A0L775_CUCSA (Putative calcium-binding protein CML28 OS=Cucumis sativus GN=Csa_3G345360 PE=4 SV=1) HSP 1 Score: 148.3 bits (373), Expect = 4.2e-33 Identity = 74/83 (89.16%), Postives = 77/83 (92.77%), Query Frame = 1
BLAST of Cla013179 vs. TrEMBL
Match: B9T2J7_RICCO (Dc3, putative OS=Ricinus communis GN=RCOM_0284980 PE=4 SV=1) HSP 1 Score: 107.5 bits (267), Expect = 8.2e-21 Identity = 56/84 (66.67%), Postives = 62/84 (73.81%), Query Frame = 1
BLAST of Cla013179 vs. TrEMBL
Match: F6HKV0_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_08s0007g08830 PE=4 SV=1) HSP 1 Score: 105.1 bits (261), Expect = 4.1e-20 Identity = 54/84 (64.29%), Postives = 62/84 (73.81%), Query Frame = 1
BLAST of Cla013179 vs. TrEMBL
Match: R0GAJ1_9BRAS (Uncharacterized protein OS=Capsella rubella GN=CARUB_v10015861mg PE=4 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 9.0e-20 Identity = 54/80 (67.50%), Postives = 60/80 (75.00%), Query Frame = 1
BLAST of Cla013179 vs. TrEMBL
Match: I1MBX4_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_14G216000 PE=4 SV=1) HSP 1 Score: 102.8 bits (255), Expect = 2.0e-19 Identity = 52/84 (61.90%), Postives = 63/84 (75.00%), Query Frame = 1
BLAST of Cla013179 vs. NCBI nr
Match: gi|659114464|ref|XP_008457063.1| (PREDICTED: polcalcin Bra n 2-like [Cucumis melo]) HSP 1 Score: 156.4 bits (394), Expect = 2.2e-35 Identity = 76/83 (91.57%), Postives = 80/83 (96.39%), Query Frame = 1
BLAST of Cla013179 vs. NCBI nr
Match: gi|449464146|ref|XP_004149790.1| (PREDICTED: probable calcium-binding protein CML28 [Cucumis sativus]) HSP 1 Score: 148.3 bits (373), Expect = 6.0e-33 Identity = 74/83 (89.16%), Postives = 77/83 (92.77%), Query Frame = 1
BLAST of Cla013179 vs. NCBI nr
Match: gi|255583413|ref|XP_002532466.1| (PREDICTED: polcalcin Che a 3 [Ricinus communis]) HSP 1 Score: 107.5 bits (267), Expect = 1.2e-20 Identity = 56/84 (66.67%), Postives = 62/84 (73.81%), Query Frame = 1
BLAST of Cla013179 vs. NCBI nr
Match: gi|225441878|ref|XP_002284297.1| (PREDICTED: polcalcin Che a 3 [Vitis vinifera]) HSP 1 Score: 105.1 bits (261), Expect = 5.8e-20 Identity = 54/84 (64.29%), Postives = 62/84 (73.81%), Query Frame = 1
BLAST of Cla013179 vs. NCBI nr
Match: gi|565484066|ref|XP_006299673.1| (hypothetical protein CARUB_v10015861mg [Capsella rubella]) HSP 1 Score: 104.0 bits (258), Expect = 1.3e-19 Identity = 54/80 (67.50%), Postives = 60/80 (75.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of watermelon (97103)
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|