Carg24222 (gene) Silver-seed gourd
The following sequences are available for this feature:
Legend: polypeptideCDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCGGAGAGTGACATAAGCGCAGCCGAGTGCGAGAGGATCTTCAAGCGATTCGACGCGAACGGCGACGGGATGATATCGGCGGCGGAGCTGGTCGATGCGTTGAACGGATTGGGAGTGAACGCGGAGGAGGCGAAGAGGATGATGGACGCGATTGACAAAGACGGCGATGGGTTCATATCGTTGGAAGAGTTCGCGGATTTCGCGAAGGATAATCGCGCGTTGATGAAAGATTTTGCGAAGGCGTTTTAA ATGGCGGAGAGTGACATAAGCGCAGCCGAGTGCGAGAGGATCTTCAAGCGATTCGACGCGAACGGCGACGGGATGATATCGGCGGCGGAGCTGGTCGATGCGTTGAACGGATTGGGAGTGAACGCGGAGGAGGCGAAGAGGATGATGGACGCGATTGACAAAGACGGCGATGGGTTCATATCGTTGGAAGAGTTCGCGGATTTCGCGAAGGATAATCGCGCGTTGATGAAAGATTTTGCGAAGGCGTTTTAA ATGGCGGAGAGTGACATAAGCGCAGCCGAGTGCGAGAGGATCTTCAAGCGATTCGACGCGAACGGCGACGGGATGATATCGGCGGCGGAGCTGGTCGATGCGTTGAACGGATTGGGAGTGAACGCGGAGGAGGCGAAGAGGATGATGGACGCGATTGACAAAGACGGCGATGGGTTCATATCGTTGGAAGAGTTCGCGGATTTCGCGAAGGATAATCGCGCGTTGATGAAAGATTTTGCGAAGGCGTTTTAA MAESDISAAECERIFKRFDANGDGMISAAELVDALNGLGVNAEEAKRMMDAIDKDGDGFISLEEFADFAKDNRALMKDFAKAF
BLAST of Carg24222 vs. NCBI nr
Match: XP_022935297.1 (probable calcium-binding protein CML28 [Cucurbita moschata]) HSP 1 Score: 99.4 bits (246), Expect = 6.2e-18 Identity = 83/83 (100.00%), Postives = 83/83 (100.00%), Query Frame = 0
BLAST of Carg24222 vs. NCBI nr
Match: XP_023526616.1 (probable calcium-binding protein CML28 [Cucurbita pepo subsp. pepo]) HSP 1 Score: 99.0 bits (245), Expect = 8.1e-18 Identity = 82/83 (98.80%), Postives = 83/83 (100.00%), Query Frame = 0
BLAST of Carg24222 vs. NCBI nr
Match: XP_022982739.1 (polcalcin Syr v 3-like [Cucurbita maxima]) HSP 1 Score: 93.6 bits (231), Expect = 3.4e-16 Identity = 80/83 (96.39%), Postives = 81/83 (97.59%), Query Frame = 0
BLAST of Carg24222 vs. NCBI nr
Match: XP_022948513.1 (probable calcium-binding protein CML28 [Cucurbita moschata] >XP_022998721.1 probable calcium-binding protein CML28 [Cucurbita maxima] >XP_023523664.1 probable calcium-binding protein CML28 [Cucurbita pepo subsp. pepo]) HSP 1 Score: 81.6 bits (200), Expect = 1.3e-12 Identity = 69/83 (83.13%), Postives = 74/83 (89.16%), Query Frame = 0
BLAST of Carg24222 vs. NCBI nr
Match: XP_016902062.1 (PREDICTED: polcalcin Bra n 2-like [Cucumis melo]) HSP 1 Score: 77.8 bits (190), Expect = 1.9e-11 Identity = 71/83 (85.54%), Postives = 76/83 (91.57%), Query Frame = 0
BLAST of Carg24222 vs. TAIR10
Match: AT3G03430.1 (Calcium-binding EF-hand family protein) HSP 1 Score: 53.5 bits (127), Expect = 7.1e-08 Identity = 35/76 (46.05%), Postives = 37/76 (48.68%), Query Frame = 0
BLAST of Carg24222 vs. TAIR10
Match: AT5G17480.1 (pollen calcium-binding protein 1) HSP 1 Score: 50.8 bits (120), Expect = 4.6e-07 Identity = 34/76 (44.74%), Postives = 37/76 (48.68%), Query Frame = 0
BLAST of Carg24222 vs. Swiss-Prot
Match: sp|Q9SRP7|CML28_ARATH (Probable calcium-binding protein CML28 OS=Arabidopsis thaliana OX=3702 GN=CML28 PE=3 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 1.3e-06 Identity = 35/76 (46.05%), Postives = 37/76 (48.68%), Query Frame = 0
BLAST of Carg24222 vs. Swiss-Prot
Match: sp|P69199|POLC2_BRACM (Polcalcin Bra r 2 OS=Brassica campestris OX=3711 PE=1 SV=1) HSP 1 Score: 52.4 bits (124), Expect = 2.9e-06 Identity = 49/76 (64.47%), Postives = 52/76 (68.42%), Query Frame = 0
BLAST of Carg24222 vs. Swiss-Prot
Match: sp|P69198|POLC2_BRANA (Polcalcin Bra n 2 OS=Brassica napus OX=3708 PE=1 SV=1) HSP 1 Score: 52.4 bits (124), Expect = 2.9e-06 Identity = 49/76 (64.47%), Postives = 52/76 (68.42%), Query Frame = 0
BLAST of Carg24222 vs. Swiss-Prot
Match: sp|Q39419|POLC4_BETPN (Polcalcin Bet v 4 OS=Betula pendula OX=3505 GN=BETV4 PE=1 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 4.9e-06 Identity = 34/76 (44.74%), Postives = 37/76 (48.68%), Query Frame = 0
BLAST of Carg24222 vs. Swiss-Prot
Match: sp|O81092|ALL3_OLEEU (Polcalcin Ole e 3 OS=Olea europaea OX=4146 GN=OLE3 PE=1 SV=1) HSP 1 Score: 51.2 bits (121), Expect = 6.3e-06 Identity = 34/84 (40.48%), Postives = 40/84 (47.62%), Query Frame = 0
BLAST of Carg24222 vs. TrEMBL
Match: tr|A0A1S4E1G1|A0A1S4E1G1_CUCME (polcalcin Bra n 2-like OS=Cucumis melo OX=3656 GN=LOC103496835 PE=4 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 1.3e-11 Identity = 71/83 (85.54%), Postives = 76/83 (91.57%), Query Frame = 0
BLAST of Carg24222 vs. TrEMBL
Match: tr|A0A0A0L775|A0A0A0L775_CUCSA (Putative calcium-binding protein CML28 OS=Cucumis sativus OX=3659 GN=Csa_3G345360 PE=4 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 1.2e-09 Identity = 69/83 (83.13%), Postives = 74/83 (89.16%), Query Frame = 0
BLAST of Carg24222 vs. TrEMBL
Match: tr|A0A2I0KIR2|A0A2I0KIR2_PUNGR (Uncharacterized protein OS=Punica granatum OX=22663 GN=CRG98_011201 PE=4 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 2.3e-05 Identity = 59/84 (70.24%), Postives = 62/84 (73.81%), Query Frame = 0
BLAST of Carg24222 vs. TrEMBL
Match: tr|W9RDJ1|W9RDJ1_9ROSA (Polcalcin Syr v 3 OS=Morus notabilis OX=981085 GN=L484_006237 PE=4 SV=1) HSP 1 Score: 56.2 bits (134), Expect = 4.0e-05 Identity = 28/39 (71.79%), Postives = 29/39 (74.36%), Query Frame = 0
BLAST of Carg24222 vs. TrEMBL
Match: tr|A0A164UEU9|A0A164UEU9_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus OX=79200 GN=DCAR_025870 PE=4 SV=1) HSP 1 Score: 56.2 bits (134), Expect = 4.0e-05 Identity = 52/81 (64.20%), Postives = 56/81 (69.14%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of silver-seed gourd
Date Performed: 2019-03-07
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene: None |