Cla97C05G080020 (gene) Watermelon (97103) v2
The following sequences are available for this feature:
Legend: polypeptideCDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGTCGTCGTGGAGGGAGTCGGATGTGTTGGAGTCGATCCGTCAACATCTTCTGGAAGAAAATAACAGTGGGAGTGGGAGTGGGAATGGGGATGGCCGGGAATCAAGTGCAATTATTATTCAGCATCATAAGAAGGAGGCGGCGAAGAATGAAGTGCAACTACTGCAATTCAAGGGAGTGAGGCGGAGGCCATGGGGGAAATACGCGGCGGAGATCAGAGATCCAAAGAGAAACGGAGCCAGAACATGGCTGGGGACGTTTGACACCGCCCAAGACGCAGCTCTGGCCTACGATCGAGCGGCTTTCAAAATCCGAGGAGCTAAGGCAAAGCTCAACTTTCCGCATCTCATTGATTCTGATTCTATTTGGTCCACTTCTACTTCCACTTCTGCTTCTACTTCCACTTCCACTTCTGCTTCTACTAAGCGTCCTCCGAGTCCAACCCACGCCCAGCATCGAACTTCTGCTTCAAAACGCCGCTGA ATGTCGTCGTGGAGGGAGTCGGATGTGTTGGAGTCGATCCGTCAACATCTTCTGGAAGAAAATAACAGTGGGAGTGGGAGTGGGAATGGGGATGGCCGGGAATCAAGTGCAATTATTATTCAGCATCATAAGAAGGAGGCGGCGAAGAATGAAGTGCAACTACTGCAATTCAAGGGAGTGAGGCGGAGGCCATGGGGGAAATACGCGGCGGAGATCAGAGATCCAAAGAGAAACGGAGCCAGAACATGGCTGGGGACGTTTGACACCGCCCAAGACGCAGCTCTGGCCTACGATCGAGCGGCTTTCAAAATCCGAGGAGCTAAGGCAAAGCTCAACTTTCCGCATCTCATTGATTCTGATTCTATTTGGTCCACTTCTACTTCCACTTCTGCTTCTACTTCCACTTCCACTTCTGCTTCTACTAAGCGTCCTCCGAGTCCAACCCACGCCCAGCATCGAACTTCTGCTTCAAAACGCCGCTGA ATGTCGTCGTGGAGGGAGTCGGATGTGTTGGAGTCGATCCGTCAACATCTTCTGGAAGAAAATAACAGTGGGAGTGGGAGTGGGAATGGGGATGGCCGGGAATCAAGTGCAATTATTATTCAGCATCATAAGAAGGAGGCGGCGAAGAATGAAGTGCAACTACTGCAATTCAAGGGAGTGAGGCGGAGGCCATGGGGGAAATACGCGGCGGAGATCAGAGATCCAAAGAGAAACGGAGCCAGAACATGGCTGGGGACGTTTGACACCGCCCAAGACGCAGCTCTGGCCTACGATCGAGCGGCTTTCAAAATCCGAGGAGCTAAGGCAAAGCTCAACTTTCCGCATCTCATTGATTCTGATTCTATTTGGTCCACTTCTACTTCCACTTCTGCTTCTACTTCCACTTCCACTTCTGCTTCTACTAAGCGTCCTCCGAGTCCAACCCACGCCCAGCATCGAACTTCTGCTTCAAAACGCCGCTGA MSSWRESDVLESIRQHLLEENNSGSGSGNGDGRESSAIIIQHHKKEAAKNEVQLLQFKGVRRRPWGKYAAEIRDPKRNGARTWLGTFDTAQDAALAYDRAAFKIRGAKAKLNFPHLIDSDSIWSTSTSTSASTSTSTSASTKRPPSPTHAQHRTSASKRR
BLAST of Cla97C05G080020 vs. NCBI nr
Match: XP_008439349.1 (PREDICTED: ethylene-responsive transcription factor 13-like [Cucumis melo]) HSP 1 Score: 169.5 bits (428), Expect = 9.4e-39 Identity = 93/124 (75.00%), Postives = 99/124 (79.84%), Query Frame = 0
BLAST of Cla97C05G080020 vs. NCBI nr
Match: XP_004134276.1 (PREDICTED: ethylene-responsive transcription factor 13-like [Cucumis sativus] >KGN56335.1 hypothetical protein Csa_3G116720 [Cucumis sativus]) HSP 1 Score: 167.5 bits (423), Expect = 3.6e-38 Identity = 89/120 (74.17%), Postives = 94/120 (78.33%), Query Frame = 0
BLAST of Cla97C05G080020 vs. NCBI nr
Match: XP_022151925.1 (ethylene-responsive transcription factor 14-like [Momordica charantia]) HSP 1 Score: 134.4 bits (337), Expect = 3.4e-28 Identity = 83/116 (71.55%), Postives = 90/116 (77.59%), Query Frame = 0
BLAST of Cla97C05G080020 vs. NCBI nr
Match: PON60851.1 (AP2/ERF transcription factor [Parasponia andersonii]) HSP 1 Score: 129.8 bits (325), Expect = 8.3e-27 Identity = 61/80 (76.25%), Postives = 71/80 (88.75%), Query Frame = 0
BLAST of Cla97C05G080020 vs. NCBI nr
Match: PON41515.1 (AP2/ERF transcription factor [Trema orientalis]) HSP 1 Score: 129.4 bits (324), Expect = 1.1e-26 Identity = 61/80 (76.25%), Postives = 71/80 (88.75%), Query Frame = 0
BLAST of Cla97C05G080020 vs. TrEMBL
Match: tr|A0A1S3AZ89|A0A1S3AZ89_CUCME (ethylene-responsive transcription factor 13-like OS=Cucumis melo OX=3656 GN=LOC103484163 PE=4 SV=1) HSP 1 Score: 169.5 bits (428), Expect = 6.2e-39 Identity = 93/124 (75.00%), Postives = 99/124 (79.84%), Query Frame = 0
BLAST of Cla97C05G080020 vs. TrEMBL
Match: tr|A0A0A0L2V9|A0A0A0L2V9_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_3G116720 PE=4 SV=1) HSP 1 Score: 167.5 bits (423), Expect = 2.4e-38 Identity = 89/120 (74.17%), Postives = 94/120 (78.33%), Query Frame = 0
BLAST of Cla97C05G080020 vs. TrEMBL
Match: tr|A0A2P5CII2|A0A2P5CII2_PARAD (AP2/ERF transcription factor OS=Parasponia andersonii OX=3476 GN=PanERF18 PE=4 SV=1) HSP 1 Score: 129.8 bits (325), Expect = 5.5e-27 Identity = 61/80 (76.25%), Postives = 71/80 (88.75%), Query Frame = 0
BLAST of Cla97C05G080020 vs. TrEMBL
Match: tr|A0A2P5AYA7|A0A2P5AYA7_9ROSA (AP2/ERF transcription factor OS=Trema orientalis OX=63057 GN=TorERF18 PE=4 SV=1) HSP 1 Score: 129.4 bits (324), Expect = 7.2e-27 Identity = 61/80 (76.25%), Postives = 71/80 (88.75%), Query Frame = 0
BLAST of Cla97C05G080020 vs. TrEMBL
Match: tr|A0A0A0L893|A0A0A0L893_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_3G116730 PE=4 SV=1) HSP 1 Score: 126.3 bits (316), Expect = 6.1e-26 Identity = 59/86 (68.60%), Postives = 74/86 (86.05%), Query Frame = 0
BLAST of Cla97C05G080020 vs. Swiss-Prot
Match: sp|Q8L9K1|ERF99_ARATH (Ethylene-responsive transcription factor 13 OS=Arabidopsis thaliana OX=3702 GN=ERF13 PE=2 SV=2) HSP 1 Score: 116.7 bits (291), Expect = 2.4e-25 Identity = 50/65 (76.92%), Postives = 62/65 (95.38%), Query Frame = 0
BLAST of Cla97C05G080020 vs. Swiss-Prot
Match: sp|O04681|PTI5_SOLLC (Pathogenesis-related genes transcriptional activator PTI5 OS=Solanum lycopersicum OX=4081 GN=PTI5 PE=2 SV=1) HSP 1 Score: 104.8 bits (260), Expect = 9.3e-22 Identity = 48/67 (71.64%), Postives = 59/67 (88.06%), Query Frame = 0
BLAST of Cla97C05G080020 vs. Swiss-Prot
Match: sp|O80337|EF100_ARATH (Ethylene-responsive transcription factor 1A OS=Arabidopsis thaliana OX=3702 GN=ERF1A PE=1 SV=2) HSP 1 Score: 104.4 bits (259), Expect = 1.2e-21 Identity = 45/63 (71.43%), Postives = 58/63 (92.06%), Query Frame = 0
BLAST of Cla97C05G080020 vs. Swiss-Prot
Match: sp|Q9LW50|ERF2_NICSY (Ethylene-responsive transcription factor 2 OS=Nicotiana sylvestris OX=4096 GN=ERF2 PE=2 SV=1) HSP 1 Score: 103.2 bits (256), Expect = 2.7e-21 Identity = 43/61 (70.49%), Postives = 57/61 (93.44%), Query Frame = 0
BLAST of Cla97C05G080020 vs. Swiss-Prot
Match: sp|Q40479|ERF2_TOBAC (Ethylene-responsive transcription factor 2 OS=Nicotiana tabacum OX=4097 GN=ERF2 PE=2 SV=1) HSP 1 Score: 103.2 bits (256), Expect = 2.7e-21 Identity = 43/61 (70.49%), Postives = 57/61 (93.44%), Query Frame = 0
BLAST of Cla97C05G080020 vs. TAIR10
Match: AT2G44840.1 (ethylene-responsive element binding factor 13) HSP 1 Score: 116.7 bits (291), Expect = 1.3e-26 Identity = 50/65 (76.92%), Postives = 62/65 (95.38%), Query Frame = 0
BLAST of Cla97C05G080020 vs. TAIR10
Match: AT4G17500.1 (ethylene responsive element binding factor 1) HSP 1 Score: 104.4 bits (259), Expect = 6.8e-23 Identity = 45/63 (71.43%), Postives = 58/63 (92.06%), Query Frame = 0
BLAST of Cla97C05G080020 vs. TAIR10
Match: AT5G47220.1 (ethylene responsive element binding factor 2) HSP 1 Score: 102.1 bits (253), Expect = 3.4e-22 Identity = 45/68 (66.18%), Postives = 59/68 (86.76%), Query Frame = 0
BLAST of Cla97C05G080020 vs. TAIR10
Match: AT3G23220.1 (Integrase-type DNA-binding superfamily protein) HSP 1 Score: 100.1 bits (248), Expect = 1.3e-21 Identity = 44/61 (72.13%), Postives = 54/61 (88.52%), Query Frame = 0
BLAST of Cla97C05G080020 vs. TAIR10
Match: AT3G23230.1 (Integrase-type DNA-binding superfamily protein) HSP 1 Score: 100.1 bits (248), Expect = 1.3e-21 Identity = 45/60 (75.00%), Postives = 53/60 (88.33%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of watermelon 97103 v2
Date Performed: 2019-05-12
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|