CSPI03G15470 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGGAGGAAGAGATTATGGGAATGACTATGAAGGTCATTATTTTGAAGATCAAAGTGGTGAAATTAGAAGAAGGATGTGGCCAAGTGATGAAGATAGAGGAAGTAGATGGGTTGCTGAGCCTGGAATTGATCGTAAAGCTTCTGCTTTTATTGCTAGATTCTACGAAGCTCGTGTTTCTGATCCCGAACGCCAAACTCTTTCTCTT ATGGGAGGAAGAGATTATGGGAATGACTATGAAGGTCATTATTTTGAAGATCAAAGTGGTGAAATTAGAAGAAGGATGTGGCCAAGTGATGAAGATAGAGGAAGTAGATGGGTTGCTGAGCCTGGAATTGATCGTAAAGCTTCTGCTTTTATTGCTAGATTCTACGAAGCTCGTGTTTCTGATCCCGAACGCCAAACTCTTTCTCTT ATGGGAGGAAGAGATTATGGGAATGACTATGAAGGTCATTATTTTGAAGATCAAAGTGGTGAAATTAGAAGAAGGATGTGGCCAAGTGATGAAGATAGAGGAAGTAGATGGGTTGCTGAGCCTGGAATTGATCGTAAAGCTTCTGCTTTTATTGCTAGATTCTACGAAGCTCGTGTTTCTGATCCCGAACGCCAAACTCTTTCTCTT
BLAST of CSPI03G15470 vs. TrEMBL
Match: A0A0A0LAW1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G171730 PE=4 SV=1) HSP 1 Score: 146.7 bits (369), Expect = 1.0e-32 Identity = 69/69 (100.00%), Postives = 69/69 (100.00%), Query Frame = 1
BLAST of CSPI03G15470 vs. TrEMBL
Match: E5GC50_CUCME (Putative uncharacterized protein OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 135.6 bits (340), Expect = 2.3e-29 Identity = 66/69 (95.65%), Postives = 67/69 (97.10%), Query Frame = 1
BLAST of CSPI03G15470 vs. TrEMBL
Match: W9RIP1_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_026133 PE=4 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 3.6e-14 Identity = 46/66 (69.70%), Postives = 51/66 (77.27%), Query Frame = 1
BLAST of CSPI03G15470 vs. TrEMBL
Match: A0A067E1Z2_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g038144mg PE=4 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 1.7e-11 Identity = 34/48 (70.83%), Postives = 41/48 (85.42%), Query Frame = 1
BLAST of CSPI03G15470 vs. TrEMBL
Match: V4S2I2_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10013220mg PE=4 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 1.7e-11 Identity = 34/48 (70.83%), Postives = 41/48 (85.42%), Query Frame = 1
BLAST of CSPI03G15470 vs. TAIR10
Match: AT5G26620.1 (AT5G26620.1 unknown protein) HSP 1 Score: 64.3 bits (155), Expect = 3.3e-11 Identity = 31/44 (70.45%), Postives = 37/44 (84.09%), Query Frame = 1
BLAST of CSPI03G15470 vs. TAIR10
Match: AT3G05858.1 (AT3G05858.1 unknown protein) HSP 1 Score: 61.2 bits (147), Expect = 2.8e-10 Identity = 34/52 (65.38%), Postives = 39/52 (75.00%), Query Frame = 1
BLAST of CSPI03G15470 vs. NCBI nr
Match: gi|700202083|gb|KGN57216.1| (hypothetical protein Csa_3G171730 [Cucumis sativus]) HSP 1 Score: 146.7 bits (369), Expect = 1.5e-32 Identity = 69/69 (100.00%), Postives = 69/69 (100.00%), Query Frame = 1
BLAST of CSPI03G15470 vs. NCBI nr
Match: gi|659077069|ref|XP_008439016.1| (PREDICTED: uncharacterized protein LOC103483934 [Cucumis melo]) HSP 1 Score: 135.6 bits (340), Expect = 3.3e-29 Identity = 66/69 (95.65%), Postives = 67/69 (97.10%), Query Frame = 1
BLAST of CSPI03G15470 vs. NCBI nr
Match: gi|307136210|gb|ADN34048.1| (hypothetical protein [Cucumis melo subsp. melo]) HSP 1 Score: 135.6 bits (340), Expect = 3.3e-29 Identity = 66/69 (95.65%), Postives = 67/69 (97.10%), Query Frame = 1
BLAST of CSPI03G15470 vs. NCBI nr
Match: gi|703107460|ref|XP_010098752.1| (hypothetical protein L484_026133 [Morus notabilis]) HSP 1 Score: 85.1 bits (209), Expect = 5.2e-14 Identity = 46/66 (69.70%), Postives = 51/66 (77.27%), Query Frame = 1
BLAST of CSPI03G15470 vs. NCBI nr
Match: gi|657995939|ref|XP_008390328.1| (PREDICTED: uncharacterized protein LOC103452598 [Malus domestica]) HSP 1 Score: 76.6 bits (187), Expect = 1.8e-11 Identity = 38/62 (61.29%), Postives = 47/62 (75.81%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|