CmoCh15G007660 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCTGATGATGCTAAAGACAAAGTTGACCGAGACCGAATTTTCAAGCGCTTCGACGCCAATGGCGACGGTAGGATCTCTGCGTCGGAGCTCGGTGAATCCTTGAAGACGCTTGGCTCCGTTACCCCTGACGAAGTGCAGCGGATGATGGCAGAGATCGACACCGACGGCGACGGGTACATTTCATACGAAGAGTTCACAGATTTCGCCTGTGCCAACCGTGGTTTAATCAGAGATGTTGCAAAGATATTCTAA ATGGCTGATGATGCTAAAGACAAAGTTGACCGAGACCGAATTTTCAAGCGCTTCGACGCCAATGGCGACGGTAGGATCTCTGCGTCGGAGCTCGGTGAATCCTTGAAGACGCTTGGCTCCGTTACCCCTGACGAAGTGCAGCGGATGATGGCAGAGATCGACACCGACGGCGACGGGTACATTTCATACGAAGAGTTCACAGATTTCGCCTGTGCCAACCGTGGTTTAATCAGAGATGTTGCAAAGATATTCTAA ATGGCTGATGATGCTAAAGACAAAGTTGACCGAGACCGAATTTTCAAGCGCTTCGACGCCAATGGCGACGGTAGGATCTCTGCGTCGGAGCTCGGTGAATCCTTGAAGACGCTTGGCTCCGTTACCCCTGACGAAGTGCAGCGGATGATGGCAGAGATCGACACCGACGGCGACGGGTACATTTCATACGAAGAGTTCACAGATTTCGCCTGTGCCAACCGTGGTTTAATCAGAGATGTTGCAAAGATATTCTAA
BLAST of CmoCh15G007660 vs. Swiss-Prot
Match: POLC4_BETPN (Polcalcin Bet v 4 OS=Betula pendula GN=BETV4 PE=1 SV=1) HSP 1 Score: 137.1 bits (344), Expect = 8.8e-32 Identity = 66/85 (77.65%), Postives = 79/85 (92.94%), Query Frame = 1
BLAST of CmoCh15G007660 vs. Swiss-Prot
Match: ALL3_OLEEU (Polcalcin Ole e 3 OS=Olea europaea GN=OLE3 PE=1 SV=1) HSP 1 Score: 137.1 bits (344), Expect = 8.8e-32 Identity = 65/84 (77.38%), Postives = 78/84 (92.86%), Query Frame = 1
BLAST of CmoCh15G007660 vs. Swiss-Prot
Match: POLC3_CHEAL (Polcalcin Che a 3 OS=Chenopodium album PE=1 SV=1) HSP 1 Score: 134.0 bits (336), Expect = 7.4e-31 Identity = 63/82 (76.83%), Postives = 76/82 (92.68%), Query Frame = 1
BLAST of CmoCh15G007660 vs. Swiss-Prot
Match: POLC2_BRANA (Polcalcin Bra n 2 OS=Brassica napus PE=1 SV=1) HSP 1 Score: 132.9 bits (333), Expect = 1.7e-30 Identity = 62/81 (76.54%), Postives = 75/81 (92.59%), Query Frame = 1
BLAST of CmoCh15G007660 vs. Swiss-Prot
Match: POLC2_BRACM (Polcalcin Bra r 2 OS=Brassica campestris PE=1 SV=1) HSP 1 Score: 132.9 bits (333), Expect = 1.7e-30 Identity = 62/81 (76.54%), Postives = 75/81 (92.59%), Query Frame = 1
BLAST of CmoCh15G007660 vs. TrEMBL
Match: A0A067KMY8_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_13424 PE=4 SV=1) HSP 1 Score: 146.0 bits (367), Expect = 2.1e-32 Identity = 70/84 (83.33%), Postives = 79/84 (94.05%), Query Frame = 1
BLAST of CmoCh15G007660 vs. TrEMBL
Match: A0A0A0KQB8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G420320 PE=4 SV=1) HSP 1 Score: 144.4 bits (363), Expect = 6.1e-32 Identity = 69/84 (82.14%), Postives = 80/84 (95.24%), Query Frame = 1
BLAST of CmoCh15G007660 vs. TrEMBL
Match: A0A151U189_CAJCA (Polcalcin Ole e 3 OS=Cajanus cajan GN=KK1_005654 PE=4 SV=1) HSP 1 Score: 141.7 bits (356), Expect = 4.0e-31 Identity = 68/84 (80.95%), Postives = 77/84 (91.67%), Query Frame = 1
BLAST of CmoCh15G007660 vs. TrEMBL
Match: A0A061EH29_THECC (Calcium-binding EF-hand family protein OS=Theobroma cacao GN=TCM_019206 PE=4 SV=1) HSP 1 Score: 140.2 bits (352), Expect = 1.2e-30 Identity = 69/84 (82.14%), Postives = 79/84 (94.05%), Query Frame = 1
BLAST of CmoCh15G007660 vs. TrEMBL
Match: W8PPL7_FRAEX (Fra e 3.01 allergen OS=Fraxinus excelsior PE=2 SV=1) HSP 1 Score: 139.4 bits (350), Expect = 2.0e-30 Identity = 66/84 (78.57%), Postives = 77/84 (91.67%), Query Frame = 1
BLAST of CmoCh15G007660 vs. TAIR10
Match: AT5G17480.1 (AT5G17480.1 pollen calcium-binding protein 1) HSP 1 Score: 129.8 bits (325), Expect = 7.9e-31 Identity = 63/81 (77.78%), Postives = 74/81 (91.36%), Query Frame = 1
BLAST of CmoCh15G007660 vs. TAIR10
Match: AT3G03430.1 (AT3G03430.1 Calcium-binding EF-hand family protein) HSP 1 Score: 129.4 bits (324), Expect = 1.0e-30 Identity = 60/81 (74.07%), Postives = 74/81 (91.36%), Query Frame = 1
BLAST of CmoCh15G007660 vs. TAIR10
Match: AT1G24620.1 (AT1G24620.1 EF hand calcium-binding protein family) HSP 1 Score: 63.9 bits (154), Expect = 5.3e-11 Identity = 28/58 (48.28%), Postives = 43/58 (74.14%), Query Frame = 1
BLAST of CmoCh15G007660 vs. TAIR10
Match: AT1G73630.1 (AT1G73630.1 EF hand calcium-binding protein family) HSP 1 Score: 63.5 bits (153), Expect = 6.9e-11 Identity = 30/55 (54.55%), Postives = 42/55 (76.36%), Query Frame = 1
BLAST of CmoCh15G007660 vs. TAIR10
Match: AT1G18210.1 (AT1G18210.1 Calcium-binding EF-hand family protein) HSP 1 Score: 61.2 bits (147), Expect = 3.4e-10 Identity = 32/84 (38.10%), Postives = 52/84 (61.90%), Query Frame = 1
BLAST of CmoCh15G007660 vs. NCBI nr
Match: gi|1009126557|ref|XP_015880220.1| (PREDICTED: polcalcin Bet v 4 [Ziziphus jujuba]) HSP 1 Score: 147.9 bits (372), Expect = 7.9e-33 Identity = 71/84 (84.52%), Postives = 78/84 (92.86%), Query Frame = 1
BLAST of CmoCh15G007660 vs. NCBI nr
Match: gi|802634001|ref|XP_012077783.1| (PREDICTED: polcalcin Che a 3-like [Jatropha curcas]) HSP 1 Score: 146.0 bits (367), Expect = 3.0e-32 Identity = 70/84 (83.33%), Postives = 79/84 (94.05%), Query Frame = 1
BLAST of CmoCh15G007660 vs. NCBI nr
Match: gi|659121144|ref|XP_008460520.1| (PREDICTED: polcalcin Ole e 3 [Cucumis melo]) HSP 1 Score: 145.6 bits (366), Expect = 3.9e-32 Identity = 70/84 (83.33%), Postives = 80/84 (95.24%), Query Frame = 1
BLAST of CmoCh15G007660 vs. NCBI nr
Match: gi|449445084|ref|XP_004140303.1| (PREDICTED: polcalcin Ole e 3 [Cucumis sativus]) HSP 1 Score: 144.4 bits (363), Expect = 8.8e-32 Identity = 69/84 (82.14%), Postives = 80/84 (95.24%), Query Frame = 1
BLAST of CmoCh15G007660 vs. NCBI nr
Match: gi|1012361862|gb|KYP73045.1| (Polcalcin Ole e 3 [Cajanus cajan]) HSP 1 Score: 141.7 bits (356), Expect = 5.7e-31 Identity = 68/84 (80.95%), Postives = 77/84 (91.67%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|