CSPI05G15000 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCTGATGATCCTCAAGACCAAGCTGAACGTGACCGCATTTTCAAGCGCTTTGACGCCAATGGCGACGGTAAGATCTCTTCCGCTGAGCTTGGGGAAGCCTTGAAGACCCTCGGCTCCGTCACCGCCGACGAAGTACAACGGATGATGGCTGAGATCGACACTGACGGTGATGGCTTCATTTCGTACGAAGAGTTCACAGATTTCGCTCGTGCTAACCGTGGATTAGTCAAGGATGTTGCTAAGATATTCTAA ATGGCTGATGATCCTCAAGACCAAGCTGAACGTGACCGCATTTTCAAGCGCTTTGACGCCAATGGCGACGGTAAGATCTCTTCCGCTGAGCTTGGGGAAGCCTTGAAGACCCTCGGCTCCGTCACCGCCGACGAAGTACAACGGATGATGGCTGAGATCGACACTGACGGTGATGGCTTCATTTCGTACGAAGAGTTCACAGATTTCGCTCGTGCTAACCGTGGATTAGTCAAGGATGTTGCTAAGATATTCTAA ATGGCTGATGATCCTCAAGACCAAGCTGAACGTGACCGCATTTTCAAGCGCTTTGACGCCAATGGCGACGGTAAGATCTCTTCCGCTGAGCTTGGGGAAGCCTTGAAGACCCTCGGCTCCGTCACCGCCGACGAAGTACAACGGATGATGGCTGAGATCGACACTGACGGTGATGGCTTCATTTCGTACGAAGAGTTCACAGATTTCGCTCGTGCTAACCGTGGATTAGTCAAGGATGTTGCTAAGATATTCTAA
BLAST of CSPI05G15000 vs. Swiss-Prot
Match: ALL3_OLEEU (Polcalcin Ole e 3 OS=Olea europaea GN=OLE3 PE=1 SV=1) HSP 1 Score: 147.5 bits (371), Expect = 6.6e-35 Identity = 73/84 (86.90%), Postives = 79/84 (94.05%), Query Frame = 1
BLAST of CSPI05G15000 vs. Swiss-Prot
Match: POLC4_BETPN (Polcalcin Bet v 4 OS=Betula pendula GN=BETV4 PE=1 SV=1) HSP 1 Score: 146.7 bits (369), Expect = 1.1e-34 Identity = 73/85 (85.88%), Postives = 81/85 (95.29%), Query Frame = 1
BLAST of CSPI05G15000 vs. Swiss-Prot
Match: POLC1_TOBAC (Polcalcin Nic t 1 OS=Nicotiana tabacum GN=Nict1 PE=1 SV=1) HSP 1 Score: 143.7 bits (361), Expect = 9.5e-34 Identity = 69/84 (82.14%), Postives = 78/84 (92.86%), Query Frame = 1
BLAST of CSPI05G15000 vs. Swiss-Prot
Match: POLC3_CHEAL (Polcalcin Che a 3 OS=Chenopodium album PE=1 SV=1) HSP 1 Score: 143.3 bits (360), Expect = 1.2e-33 Identity = 70/82 (85.37%), Postives = 78/82 (95.12%), Query Frame = 1
BLAST of CSPI05G15000 vs. Swiss-Prot
Match: POLC4_ALNGL (Polcalcin Aln g 4 OS=Alnus glutinosa PE=1 SV=1) HSP 1 Score: 142.1 bits (357), Expect = 2.8e-33 Identity = 72/85 (84.71%), Postives = 80/85 (94.12%), Query Frame = 1
BLAST of CSPI05G15000 vs. TrEMBL
Match: A0A0A0KQB8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G420320 PE=4 SV=1) HSP 1 Score: 165.2 bits (417), Expect = 3.4e-38 Identity = 83/84 (98.81%), Postives = 84/84 (100.00%), Query Frame = 1
BLAST of CSPI05G15000 vs. TrEMBL
Match: I3ST68_LOTJA (Uncharacterized protein OS=Lotus japonicus PE=2 SV=1) HSP 1 Score: 150.2 bits (378), Expect = 1.1e-33 Identity = 75/84 (89.29%), Postives = 80/84 (95.24%), Query Frame = 1
BLAST of CSPI05G15000 vs. TrEMBL
Match: G7K1Y2_MEDTR (EF hand calcium-binding family protein OS=Medicago truncatula GN=MTR_5g079470 PE=4 SV=1) HSP 1 Score: 149.4 bits (376), Expect = 1.9e-33 Identity = 73/84 (86.90%), Postives = 81/84 (96.43%), Query Frame = 1
BLAST of CSPI05G15000 vs. TrEMBL
Match: A0A151U189_CAJCA (Polcalcin Ole e 3 OS=Cajanus cajan GN=KK1_005654 PE=4 SV=1) HSP 1 Score: 149.4 bits (376), Expect = 1.9e-33 Identity = 74/84 (88.10%), Postives = 79/84 (94.05%), Query Frame = 1
BLAST of CSPI05G15000 vs. TrEMBL
Match: W8PPL7_FRAEX (Fra e 3.01 allergen OS=Fraxinus excelsior PE=2 SV=1) HSP 1 Score: 149.4 bits (376), Expect = 1.9e-33 Identity = 73/84 (86.90%), Postives = 79/84 (94.05%), Query Frame = 1
BLAST of CSPI05G15000 vs. TAIR10
Match: AT5G17480.1 (AT5G17480.1 pollen calcium-binding protein 1) HSP 1 Score: 134.0 bits (336), Expect = 4.2e-32 Identity = 67/81 (82.72%), Postives = 75/81 (92.59%), Query Frame = 1
BLAST of CSPI05G15000 vs. TAIR10
Match: AT3G03430.1 (AT3G03430.1 Calcium-binding EF-hand family protein) HSP 1 Score: 130.2 bits (326), Expect = 6.1e-31 Identity = 62/81 (76.54%), Postives = 74/81 (91.36%), Query Frame = 1
BLAST of CSPI05G15000 vs. TAIR10
Match: AT1G73630.1 (AT1G73630.1 EF hand calcium-binding protein family) HSP 1 Score: 70.1 bits (170), Expect = 7.5e-13 Identity = 35/75 (46.67%), Postives = 49/75 (65.33%), Query Frame = 1
BLAST of CSPI05G15000 vs. TAIR10
Match: AT1G24620.1 (AT1G24620.1 EF hand calcium-binding protein family) HSP 1 Score: 64.3 bits (155), Expect = 4.1e-11 Identity = 30/60 (50.00%), Postives = 44/60 (73.33%), Query Frame = 1
BLAST of CSPI05G15000 vs. TAIR10
Match: AT1G18210.1 (AT1G18210.1 Calcium-binding EF-hand family protein) HSP 1 Score: 62.8 bits (151), Expect = 1.2e-10 Identity = 31/71 (43.66%), Postives = 47/71 (66.20%), Query Frame = 1
BLAST of CSPI05G15000 vs. NCBI nr
Match: gi|449445084|ref|XP_004140303.1| (PREDICTED: polcalcin Ole e 3 [Cucumis sativus]) HSP 1 Score: 165.2 bits (417), Expect = 4.9e-38 Identity = 83/84 (98.81%), Postives = 84/84 (100.00%), Query Frame = 1
BLAST of CSPI05G15000 vs. NCBI nr
Match: gi|659121144|ref|XP_008460520.1| (PREDICTED: polcalcin Ole e 3 [Cucumis melo]) HSP 1 Score: 164.1 bits (414), Expect = 1.1e-37 Identity = 82/84 (97.62%), Postives = 84/84 (100.00%), Query Frame = 1
BLAST of CSPI05G15000 vs. NCBI nr
Match: gi|388510788|gb|AFK43460.1| (unknown [Lotus japonicus]) HSP 1 Score: 150.2 bits (378), Expect = 1.6e-33 Identity = 75/84 (89.29%), Postives = 80/84 (95.24%), Query Frame = 1
BLAST of CSPI05G15000 vs. NCBI nr
Match: gi|589912891|gb|AHL24661.1| (Fra e 3.01 allergen [Fraxinus excelsior]) HSP 1 Score: 149.4 bits (376), Expect = 2.8e-33 Identity = 73/84 (86.90%), Postives = 79/84 (94.05%), Query Frame = 1
BLAST of CSPI05G15000 vs. NCBI nr
Match: gi|1012361862|gb|KYP73045.1| (Polcalcin Ole e 3 [Cajanus cajan]) HSP 1 Score: 149.4 bits (376), Expect = 2.8e-33 Identity = 74/84 (88.10%), Postives = 79/84 (94.05%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene: The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|