CmoCh15G003890 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCTTCCCTGGTCGGTGCTACTGCAACTGCTTCTACTGCTACTGCTACTGCCACCGATCCCTCTTTCTACTTCGATGACAAATGGAAGACGTCCAAGAAAGAGGGGTTGACCAGAACCCGCTCCTCATCATTCCCTCTCATCAAAACCTCCTCTCACAGAAGGTGCTCTTTTACTAGAAAGTGCGCTAGATTGGTCGAACAACAGAGGGCTCGATTCTACATCATGAGACGATGCGTCACCATGCTCATCTGCTGGCACGATTACACCGATTCTTGA ATGGCTTCCCTGGTCGGTGCTACTGCAACTGCTTCTACTGCTACTGCTACTGCCACCGATCCCTCTTTCTACTTCGATGACAAATGGAAGACGTCCAAGAAAGAGGGGTTGACCAGAACCCGCTCCTCATCATTCCCTCTCATCAAAACCTCCTCTCACAGAAGGTGCTCTTTTACTAGAAAGTGCGCTAGATTGGTCGAACAACAGAGGGCTCGATTCTACATCATGAGACGATGCGTCACCATGCTCATCTGCTGGCACGATTACACCGATTCTTGA ATGGCTTCCCTGGTCGGTGCTACTGCAACTGCTTCTACTGCTACTGCTACTGCCACCGATCCCTCTTTCTACTTCGATGACAAATGGAAGACGTCCAAGAAAGAGGGGTTGACCAGAACCCGCTCCTCATCATTCCCTCTCATCAAAACCTCCTCTCACAGAAGGTGCTCTTTTACTAGAAAGTGCGCTAGATTGGTCGAACAACAGAGGGCTCGATTCTACATCATGAGACGATGCGTCACCATGCTCATCTGCTGGCACGATTACACCGATTCTTGA
BLAST of CmoCh15G003890 vs. TrEMBL
Match: A0A0A0KUB0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G517730 PE=4 SV=1) HSP 1 Score: 157.1 bits (396), Expect = 1.0e-35 Identity = 78/93 (83.87%), Postives = 85/93 (91.40%), Query Frame = 1
BLAST of CmoCh15G003890 vs. TrEMBL
Match: V7B6F3_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_008G191700g PE=4 SV=1) HSP 1 Score: 122.9 bits (307), Expect = 2.1e-25 Identity = 58/81 (71.60%), Postives = 68/81 (83.95%), Query Frame = 1
BLAST of CmoCh15G003890 vs. TrEMBL
Match: A0A0S3RKU3_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.03G088500 PE=4 SV=1) HSP 1 Score: 120.9 bits (302), Expect = 7.9e-25 Identity = 56/79 (70.89%), Postives = 67/79 (84.81%), Query Frame = 1
BLAST of CmoCh15G003890 vs. TrEMBL
Match: W9R2B1_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_025336 PE=4 SV=1) HSP 1 Score: 120.2 bits (300), Expect = 1.4e-24 Identity = 58/80 (72.50%), Postives = 66/80 (82.50%), Query Frame = 1
BLAST of CmoCh15G003890 vs. TrEMBL
Match: A5BGF1_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_024942 PE=4 SV=1) HSP 1 Score: 119.8 bits (299), Expect = 1.8e-24 Identity = 59/82 (71.95%), Postives = 70/82 (85.37%), Query Frame = 1
BLAST of CmoCh15G003890 vs. TAIR10
Match: AT2G39705.1 (AT2G39705.1 ROTUNDIFOLIA like 8) HSP 1 Score: 86.3 bits (212), Expect = 1.1e-17 Identity = 48/87 (55.17%), Postives = 62/87 (71.26%), Query Frame = 1
BLAST of CmoCh15G003890 vs. TAIR10
Match: AT3G55515.1 (AT3G55515.1 ROTUNDIFOLIA like 7) HSP 1 Score: 60.5 bits (145), Expect = 6.4e-10 Identity = 35/68 (51.47%), Postives = 41/68 (60.29%), Query Frame = 1
BLAST of CmoCh15G003890 vs. TAIR10
Match: AT2G29125.1 (AT2G29125.1 ROTUNDIFOLIA like 2) HSP 1 Score: 54.3 bits (129), Expect = 4.6e-08 Identity = 33/88 (37.50%), Postives = 48/88 (54.55%), Query Frame = 1
BLAST of CmoCh15G003890 vs. TAIR10
Match: AT5G59510.1 (AT5G59510.1 ROTUNDIFOLIA like 5) HSP 1 Score: 53.9 bits (128), Expect = 6.0e-08 Identity = 32/86 (37.21%), Postives = 50/86 (58.14%), Query Frame = 1
BLAST of CmoCh15G003890 vs. TAIR10
Match: AT2G36985.1 (AT2G36985.1 DVL family protein) HSP 1 Score: 53.5 bits (127), Expect = 7.9e-08 Identity = 19/32 (59.38%), Postives = 29/32 (90.62%), Query Frame = 1
BLAST of CmoCh15G003890 vs. NCBI nr
Match: gi|778703484|ref|XP_011655374.1| (PREDICTED: uncharacterized protein LOC105435519 [Cucumis sativus]) HSP 1 Score: 157.1 bits (396), Expect = 1.4e-35 Identity = 78/93 (83.87%), Postives = 85/93 (91.40%), Query Frame = 1
BLAST of CmoCh15G003890 vs. NCBI nr
Match: gi|593489055|ref|XP_007141395.1| (hypothetical protein PHAVU_008G191700g [Phaseolus vulgaris]) HSP 1 Score: 122.9 bits (307), Expect = 3.0e-25 Identity = 58/81 (71.60%), Postives = 68/81 (83.95%), Query Frame = 1
BLAST of CmoCh15G003890 vs. NCBI nr
Match: gi|965665721|dbj|BAT81209.1| (hypothetical protein VIGAN_03088500 [Vigna angularis var. angularis]) HSP 1 Score: 120.9 bits (302), Expect = 1.1e-24 Identity = 56/79 (70.89%), Postives = 67/79 (84.81%), Query Frame = 1
BLAST of CmoCh15G003890 vs. NCBI nr
Match: gi|703099220|ref|XP_010096589.1| (hypothetical protein L484_025336 [Morus notabilis]) HSP 1 Score: 120.2 bits (300), Expect = 1.9e-24 Identity = 58/80 (72.50%), Postives = 66/80 (82.50%), Query Frame = 1
BLAST of CmoCh15G003890 vs. NCBI nr
Match: gi|147798371|emb|CAN67911.1| (hypothetical protein VITISV_024942 [Vitis vinifera]) HSP 1 Score: 119.8 bits (299), Expect = 2.5e-24 Identity = 59/82 (71.95%), Postives = 70/82 (85.37%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|