CmoCh17G003430 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGAAGCTGTTTGGTTATTCAGTGAACGCTAGTGCCGAACCCAGCTTGGGTGCGCCATGTGCGAACCACATCAAGAGATTCCAGTGCCAATTCTGCGGCCGTGAGTTCGCCAATTCTCAAGCCCTCGGCGGCCACCAGAACGCCCACAAGCGCGAGCGCCAGCTCGCCAAACAACTCCTCCCTCGTAATTTTTTCACTCCCACGCCGCCGCCCTCCGCCGCCGGAAGATCTCCTCCGCCAAATTATGAAATGCCGGTGGAAGCGCCGCCCTCGGTTGGCGGCGGTGAAATTAACGGCGAAAATAATGGCGTTGATCTCCATCTCAGTCTCGCACCGTCCTCGACCAGGATCTTCTCTTAA ATGAAGCTGTTTGGTTATTCAGTGAACGCTAGTGCCGAACCCAGCTTGGGTGCGCCATGTGCGAACCACATCAAGAGATTCCAGTGCCAATTCTGCGGCCGTGAGTTCGCCAATTCTCAAGCCCTCGGCGGCCACCAGAACGCCCACAAGCGCGAGCGCCAGCTCGCCAAACAACTCCTCCCTCGTAATTTTTTCACTCCCACGCCGCCGCCCTCCGCCGCCGGAAGATCTCCTCCGCCAAATTATGAAATGCCGGTGGAAGCGCCGCCCTCGGTTGGCGGCGGTGAAATTAACGGCGAAAATAATGGCGTTGATCTCCATCTCAGTCTCGCACCGTCCTCGACCAGGATCTTCTCTTAA ATGAAGCTGTTTGGTTATTCAGTGAACGCTAGTGCCGAACCCAGCTTGGGTGCGCCATGTGCGAACCACATCAAGAGATTCCAGTGCCAATTCTGCGGCCGTGAGTTCGCCAATTCTCAAGCCCTCGGCGGCCACCAGAACGCCCACAAGCGCGAGCGCCAGCTCGCCAAACAACTCCTCCCTCGTAATTTTTTCACTCCCACGCCGCCGCCCTCCGCCGCCGGAAGATCTCCTCCGCCAAATTATGAAATGCCGGTGGAAGCGCCGCCCTCGGTTGGCGGCGGTGAAATTAACGGCGAAAATAATGGCGTTGATCTCCATCTCAGTCTCGCACCGTCCTCGACCAGGATCTTCTCTTAA
BLAST of CmoCh17G003430 vs. Swiss-Prot
Match: ZFP6_ARATH (Zinc finger protein 6 OS=Arabidopsis thaliana GN=ZFP6 PE=2 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 9.9e-13 Identity = 49/130 (37.69%), Postives = 69/130 (53.08%), Query Frame = 1
BLAST of CmoCh17G003430 vs. Swiss-Prot
Match: ZFP5_ARATH (Zinc finger protein 5 OS=Arabidopsis thaliana GN=ZFP5 PE=2 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.7e-09 Identity = 32/70 (45.71%), Postives = 42/70 (60.00%), Query Frame = 1
BLAST of CmoCh17G003430 vs. Swiss-Prot
Match: GIS_ARATH (Zinc finger protein GIS OS=Arabidopsis thaliana GN=GIS PE=2 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 5.1e-09 Identity = 36/73 (49.32%), Postives = 45/73 (61.64%), Query Frame = 1
BLAST of CmoCh17G003430 vs. Swiss-Prot
Match: GIS2_ARATH (Zinc finger protein GIS2 OS=Arabidopsis thaliana GN=GIS2 PE=2 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 3.3e-08 Identity = 32/68 (47.06%), Postives = 38/68 (55.88%), Query Frame = 1
BLAST of CmoCh17G003430 vs. Swiss-Prot
Match: ZFP8_ARATH (Zinc finger protein 8 OS=Arabidopsis thaliana GN=ZFP8 PE=2 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 9.6e-08 Identity = 25/37 (67.57%), Postives = 30/37 (81.08%), Query Frame = 1
BLAST of CmoCh17G003430 vs. TrEMBL
Match: A0A0A0KI02_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G312040 PE=4 SV=1) HSP 1 Score: 167.9 bits (424), Expect = 7.3e-39 Identity = 92/136 (67.65%), Postives = 102/136 (75.00%), Query Frame = 1
BLAST of CmoCh17G003430 vs. TrEMBL
Match: F6H746_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_05s0077g01390 PE=4 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 4.2e-10 Identity = 62/170 (36.47%), Postives = 72/170 (42.35%), Query Frame = 1
BLAST of CmoCh17G003430 vs. TrEMBL
Match: D7KUY0_ARALL (Putative uncharacterized protein OS=Arabidopsis lyrata subsp. lyrata GN=ARALYDRAFT_475797 PE=4 SV=1) HSP 1 Score: 72.0 bits (175), Expect = 5.5e-10 Identity = 47/130 (36.15%), Postives = 66/130 (50.77%), Query Frame = 1
BLAST of CmoCh17G003430 vs. TrEMBL
Match: B9HWW5_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0010s15060g PE=4 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 1.2e-09 Identity = 59/160 (36.88%), Postives = 72/160 (45.00%), Query Frame = 1
BLAST of CmoCh17G003430 vs. TrEMBL
Match: A0A067KMC9_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_13000 PE=4 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 1.2e-09 Identity = 46/108 (42.59%), Postives = 66/108 (61.11%), Query Frame = 1
BLAST of CmoCh17G003430 vs. TAIR10
Match: AT1G67030.1 (AT1G67030.1 zinc finger protein 6) HSP 1 Score: 74.3 bits (181), Expect = 5.6e-14 Identity = 49/130 (37.69%), Postives = 69/130 (53.08%), Query Frame = 1
BLAST of CmoCh17G003430 vs. TAIR10
Match: AT1G10480.1 (AT1G10480.1 zinc finger protein 5) HSP 1 Score: 63.5 bits (153), Expect = 9.8e-11 Identity = 32/70 (45.71%), Postives = 42/70 (60.00%), Query Frame = 1
BLAST of CmoCh17G003430 vs. TAIR10
Match: AT3G58070.1 (AT3G58070.1 C2H2 and C2HC zinc fingers superfamily protein) HSP 1 Score: 62.0 bits (149), Expect = 2.9e-10 Identity = 36/73 (49.32%), Postives = 45/73 (61.64%), Query Frame = 1
BLAST of CmoCh17G003430 vs. TAIR10
Match: AT5G06650.1 (AT5G06650.1 C2H2 and C2HC zinc fingers superfamily protein) HSP 1 Score: 59.3 bits (142), Expect = 1.9e-09 Identity = 32/68 (47.06%), Postives = 38/68 (55.88%), Query Frame = 1
BLAST of CmoCh17G003430 vs. TAIR10
Match: AT2G41940.1 (AT2G41940.1 zinc finger protein 8) HSP 1 Score: 57.8 bits (138), Expect = 5.4e-09 Identity = 25/37 (67.57%), Postives = 30/37 (81.08%), Query Frame = 1
BLAST of CmoCh17G003430 vs. NCBI nr
Match: gi|449464754|ref|XP_004150094.1| (PREDICTED: zinc finger protein 6-like [Cucumis sativus]) HSP 1 Score: 167.9 bits (424), Expect = 1.0e-38 Identity = 92/136 (67.65%), Postives = 102/136 (75.00%), Query Frame = 1
BLAST of CmoCh17G003430 vs. NCBI nr
Match: gi|700192197|gb|KGN47401.1| (hypothetical protein Csa_6G312040 [Cucumis sativus]) HSP 1 Score: 167.9 bits (424), Expect = 1.0e-38 Identity = 92/136 (67.65%), Postives = 102/136 (75.00%), Query Frame = 1
BLAST of CmoCh17G003430 vs. NCBI nr
Match: gi|659117022|ref|XP_008458383.1| (PREDICTED: zinc finger protein 6-like [Cucumis melo]) HSP 1 Score: 162.5 bits (410), Expect = 4.4e-37 Identity = 89/134 (66.42%), Postives = 102/134 (76.12%), Query Frame = 1
BLAST of CmoCh17G003430 vs. NCBI nr
Match: gi|672175470|ref|XP_008807788.1| (PREDICTED: zinc finger protein 6-like [Phoenix dactylifera]) HSP 1 Score: 86.7 bits (213), Expect = 3.1e-14 Identity = 58/143 (40.56%), Postives = 71/143 (49.65%), Query Frame = 1
BLAST of CmoCh17G003430 vs. NCBI nr
Match: gi|743868952|ref|XP_010905700.1| (PREDICTED: zinc finger protein 6-like [Elaeis guineensis]) HSP 1 Score: 82.8 bits (203), Expect = 4.4e-13 Identity = 58/140 (41.43%), Postives = 72/140 (51.43%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene: |