CmoCh16G003360 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAGTGGAAAAGAGGTGCTTTAATTGCCATGGTGGGGCTGTTGCTGATGGCGGCTTTTGCAGAGTCCGCCGCCGTCCATGGCGGCGAAGTGATTCAGCTAGTTTCCGACGGAGTGAATGATTTCCCAAGGAAGATGATGAACGGTGCCCGAGGTTGCCCTAGAATCCTTATGGAGTGCGAAGTGGATTCCGACTGCCTTCCTGGTTGCATATGCCGGCCCAACGGCTTCTGTGGTTGA ATGGAGTGGAAAAGAGGTGCTTTAATTGCCATGGTGGGGCTGTTGCTGATGGCGGCTTTTGCAGAGTCCGCCGCCGTCCATGGCGGCGAAGTGATTCAGCTAGTTTCCGACGGAGTGAATGATTTCCCAAGGAAGATGATGAACGGTGCCCGAGGTTGCCCTAGAATCCTTATGGAGTGCGAAGTGGATTCCGACTGCCTTCCTGGTTGCATATGCCGGCCCAACGGCTTCTGTGGTTGA ATGGAGTGGAAAAGAGGTGCTTTAATTGCCATGGTGGGGCTGTTGCTGATGGCGGCTTTTGCAGAGTCCGCCGCCGTCCATGGCGGCGAAGTGATTCAGCTAGTTTCCGACGGAGTGAATGATTTCCCAAGGAAGATGATGAACGGTGCCCGAGGTTGCCCTAGAATCCTTATGGAGTGCGAAGTGGATTCCGACTGCCTTCCTGGTTGCATATGCCGGCCCAACGGCTTCTGTGGTTGA
BLAST of CmoCh16G003360 vs. Swiss-Prot
Match: ITR1_TRIKI (Trypsin inhibitor 1 OS=Trichosanthes kirilowii PE=3 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 2.2e-16 Identity = 41/65 (63.08%), Postives = 46/65 (70.77%), Query Frame = 1
BLAST of CmoCh16G003360 vs. Swiss-Prot
Match: ITR5_LUFAE (Trypsin inhibitor 5 OS=Luffa aegyptiaca PE=1 SV=1) HSP 1 Score: 76.6 bits (187), Expect = 1.3e-13 Identity = 37/65 (56.92%), Postives = 46/65 (70.77%), Query Frame = 1
BLAST of CmoCh16G003360 vs. Swiss-Prot
Match: ITR2_ECBEL (Trypsin inhibitor 2 OS=Ecballium elaterium PE=1 SV=2) HSP 1 Score: 58.9 bits (141), Expect = 2.9e-08 Identity = 22/28 (78.57%), Postives = 24/28 (85.71%), Query Frame = 1
BLAST of CmoCh16G003360 vs. Swiss-Prot
Match: ITR2_BRYDI (Trypsin inhibitor 2 OS=Bryonia dioica PE=1 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 6.4e-08 Identity = 21/29 (72.41%), Postives = 25/29 (86.21%), Query Frame = 1
BLAST of CmoCh16G003360 vs. Swiss-Prot
Match: ITR4_CYCPE (Trypsin inhibitor 4 OS=Cyclanthera pedata PE=1 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 3.2e-07 Identity = 22/29 (75.86%), Postives = 24/29 (82.76%), Query Frame = 1
BLAST of CmoCh16G003360 vs. TrEMBL
Match: A0A0A0KY34_CUCSA (Trypsin inhibitor 1 OS=Cucumis sativus GN=Csa_4G000810 PE=3 SV=1) HSP 1 Score: 100.5 bits (249), Expect = 9.5e-19 Identity = 47/81 (58.02%), Postives = 62/81 (76.54%), Query Frame = 1
BLAST of CmoCh16G003360 vs. TrEMBL
Match: A0A0A0KT01_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G000805 PE=3 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 5.1e-12 Identity = 42/82 (51.22%), Postives = 51/82 (62.20%), Query Frame = 1
BLAST of CmoCh16G003360 vs. TrEMBL
Match: A0A0A7HIA9_9ROSI (TIPRE5 (Fragment) OS=Momordica friesiorum GN=TIPRE5 PE=3 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 3.2e-06 Identity = 29/76 (38.16%), Postives = 45/76 (59.21%), Query Frame = 1
BLAST of CmoCh16G003360 vs. TrEMBL
Match: A0A0A7HF87_9ROSI (TIPTOP4 protein OS=Momordica subangulata GN=TIPTOP4 PE=3 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 3.2e-06 Identity = 32/79 (40.51%), Postives = 44/79 (55.70%), Query Frame = 1
BLAST of CmoCh16G003360 vs. TrEMBL
Match: A0A0A7HG47_9ROSI (TIPRE1 (Fragment) OS=Momordica anigosantha GN=TIPRE1 PE=3 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 7.1e-06 Identity = 28/72 (38.89%), Postives = 40/72 (55.56%), Query Frame = 1
BLAST of CmoCh16G003360 vs. NCBI nr
Match: gi|700197603|gb|KGN52761.1| (Trypsin inhibitor 1 [Cucumis sativus]) HSP 1 Score: 100.5 bits (249), Expect = 1.4e-18 Identity = 47/81 (58.02%), Postives = 62/81 (76.54%), Query Frame = 1
BLAST of CmoCh16G003360 vs. NCBI nr
Match: gi|8134511|sp|Q43667.1|ITR1_TRIKI (RecName: Full=Trypsin inhibitor 1; AltName: Full=TTII; AltName: Full=Trypsin inhibitor I; Flags: Precursor) HSP 1 Score: 85.9 bits (211), Expect = 3.5e-14 Identity = 41/65 (63.08%), Postives = 46/65 (70.77%), Query Frame = 1
BLAST of CmoCh16G003360 vs. NCBI nr
Match: gi|778697386|ref|XP_011654311.1| (PREDICTED: uncharacterized protein LOC105435333 [Cucumis sativus]) HSP 1 Score: 78.2 bits (191), Expect = 7.3e-12 Identity = 42/82 (51.22%), Postives = 51/82 (62.20%), Query Frame = 1
BLAST of CmoCh16G003360 vs. NCBI nr
Match: gi|700197602|gb|KGN52760.1| (hypothetical protein Csa_4G000805 [Cucumis sativus]) HSP 1 Score: 78.2 bits (191), Expect = 7.3e-12 Identity = 42/82 (51.22%), Postives = 51/82 (62.20%), Query Frame = 1
BLAST of CmoCh16G003360 vs. NCBI nr
Match: gi|462426|sp|P34950.1|ITR5_LUFAE (RecName: Full=Trypsin inhibitor 5; AltName: Full=TGT-II; AltName: Full=Trypsin inhibitor II; Flags: Precursor) HSP 1 Score: 76.6 bits (187), Expect = 2.1e-11 Identity = 37/65 (56.92%), Postives = 46/65 (70.77%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |