CmoCh16G003280 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCGAATCAGTTCGGCAGTTTAGTGGAATCCATAAAATCGAAGGTGAAGGCGCTGAAGAAGTCGAAGAAGCCGTATATAAAGATGGACAAAAGCTCCAGCGTCAAGGTTGAGATCCGTAGCCGAAAAGCTCGATTGTTGATCGATAAAACTATGAAGGTCGCCGATCGTCCTGGCAAGCGCACTGTTTCTTAGTCCTGATTATCATCTCTGTTTCTTAACGACACAGGTTTTTTTATGCTCTCTCGCTATTTTTCTCTGTGATCTTCGCGTAGTTGCAATCGCGGAATGTTCTTGTTTGTGATGATTTAG ATGGCGAATCAGTTCGGCAGTTTAGTGGAATCCATAAAATCGAAGGTGAAGGCGCTGAAGAAGTCGAAGAAGCCGTATATAAAGATGGACAAAAGCTCCAGCGTCAAGGTTGAGATCCGTAGCCGAAAAGCTCGATTGTTGATCGATAAAACTATGAAGGTCGCCGATCGTCCTGGCAAGCGCACTGTTTCTTATTGCAATCGCGGAATGTTCTTGTTTGTGATGATTTAG ATGGCGAATCAGTTCGGCAGTTTAGTGGAATCCATAAAATCGAAGGTGAAGGCGCTGAAGAAGTCGAAGAAGCCGTATATAAAGATGGACAAAAGCTCCAGCGTCAAGGTTGAGATCCGTAGCCGAAAAGCTCGATTGTTGATCGATAAAACTATGAAGGTCGCCGATCGTCCTGGCAAGCGCACTGTTTCTTATTGCAATCGCGGAATGTTCTTGTTTGTGATGATTTAG
BLAST of CmoCh16G003280 vs. TrEMBL
Match: E5GBH1_CUCME (Putative uncharacterized protein OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 112.1 bits (279), Expect = 3.0e-22 Identity = 60/64 (93.75%), Postives = 63/64 (98.44%), Query Frame = 1
BLAST of CmoCh16G003280 vs. TrEMBL
Match: A0A0A0KT27_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G000640 PE=4 SV=1) HSP 1 Score: 111.7 bits (278), Expect = 4.0e-22 Identity = 60/64 (93.75%), Postives = 62/64 (96.88%), Query Frame = 1
BLAST of CmoCh16G003280 vs. TrEMBL
Match: A0A067L7Z7_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_16375 PE=4 SV=1) HSP 1 Score: 100.1 bits (248), Expect = 1.2e-18 Identity = 54/64 (84.38%), Postives = 60/64 (93.75%), Query Frame = 1
BLAST of CmoCh16G003280 vs. TrEMBL
Match: A0A061E2D5_THECC (Uncharacterized protein OS=Theobroma cacao GN=TCM_007255 PE=4 SV=1) HSP 1 Score: 99.4 bits (246), Expect = 2.0e-18 Identity = 54/63 (85.71%), Postives = 59/63 (93.65%), Query Frame = 1
BLAST of CmoCh16G003280 vs. TrEMBL
Match: F6HBL7_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_03s0088g00270 PE=4 SV=1) HSP 1 Score: 99.4 bits (246), Expect = 2.0e-18 Identity = 54/64 (84.38%), Postives = 59/64 (92.19%), Query Frame = 1
BLAST of CmoCh16G003280 vs. TAIR10
Match: AT3G19660.1 (AT3G19660.1 unknown protein) HSP 1 Score: 79.3 bits (194), Expect = 1.1e-15 Identity = 44/63 (69.84%), Postives = 51/63 (80.95%), Query Frame = 1
BLAST of CmoCh16G003280 vs. NCBI nr
Match: gi|659108841|ref|XP_008454414.1| (PREDICTED: uncharacterized protein LOC103494825 [Cucumis melo]) HSP 1 Score: 112.1 bits (279), Expect = 4.4e-22 Identity = 60/64 (93.75%), Postives = 63/64 (98.44%), Query Frame = 1
BLAST of CmoCh16G003280 vs. NCBI nr
Match: gi|449465089|ref|XP_004150261.1| (PREDICTED: uncharacterized protein LOC101219359 [Cucumis sativus]) HSP 1 Score: 111.7 bits (278), Expect = 5.7e-22 Identity = 60/64 (93.75%), Postives = 62/64 (96.88%), Query Frame = 1
BLAST of CmoCh16G003280 vs. NCBI nr
Match: gi|802550774|ref|XP_012093162.1| (PREDICTED: uncharacterized protein LOC105650814 [Jatropha curcas]) HSP 1 Score: 100.1 bits (248), Expect = 1.7e-18 Identity = 54/64 (84.38%), Postives = 60/64 (93.75%), Query Frame = 1
BLAST of CmoCh16G003280 vs. NCBI nr
Match: gi|225429205|ref|XP_002276348.1| (PREDICTED: uncharacterized protein LOC100258330 [Vitis vinifera]) HSP 1 Score: 99.4 bits (246), Expect = 2.9e-18 Identity = 54/64 (84.38%), Postives = 59/64 (92.19%), Query Frame = 1
BLAST of CmoCh16G003280 vs. NCBI nr
Match: gi|590687494|ref|XP_007042680.1| (Uncharacterized protein TCM_007255 [Theobroma cacao]) HSP 1 Score: 99.4 bits (246), Expect = 2.9e-18 Identity = 54/63 (85.71%), Postives = 59/63 (93.65%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|