CmoCh08G002630 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCTCAAACCACGGCGACGACGATGGTGATGGCAATGACGATGGTGATGCTAGTGAGTTTATCGGGGGCATTGGCGGAAATGGACGTGTGCGGTGTGAGCCAGGACGGTCTCACGGCGTGCAAGCCGTGGGTGACGAAGCCATGCCCTACCGAGCTGCCACCGGCCGCTTGTTGCGACGGTCTCTCCAAGGCTGACTTCGGTTGCTTTTGCAACTATAAGCACTCACTCGTGCTGCCCTCGCTCGGGATTGACCCCGATCTTGCCCTTGCCTTGCCAGCCAAGTGCAGCCTCCCCAACAGCCCCTCGTGCTGA ATGGCTCAAACCACGGCGACGACGATGGTGATGGCAATGACGATGGTGATGCTAGTGAGTTTATCGGGGGCATTGGCGGAAATGGACGTGTGCGGTGTGAGCCAGGACGGTCTCACGGCGTGCAAGCCGTGGGTGACGAAGCCATGCCCTACCGAGCTGCCACCGGCCGCTTGTTGCGACGGTCTCTCCAAGGCTGACTTCGGTTGCTTTTGCAACTATAAGCACTCACTCGTGCTGCCCTCGCTCGGGATTGACCCCGATCTTGCCCTTGCCTTGCCAGCCAAGTGCAGCCTCCCCAACAGCCCCTCGTGCTGA ATGGCTCAAACCACGGCGACGACGATGGTGATGGCAATGACGATGGTGATGCTAGTGAGTTTATCGGGGGCATTGGCGGAAATGGACGTGTGCGGTGTGAGCCAGGACGGTCTCACGGCGTGCAAGCCGTGGGTGACGAAGCCATGCCCTACCGAGCTGCCACCGGCCGCTTGTTGCGACGGTCTCTCCAAGGCTGACTTCGGTTGCTTTTGCAACTATAAGCACTCACTCGTGCTGCCCTCGCTCGGGATTGACCCCGATCTTGCCCTTGCCTTGCCAGCCAAGTGCAGCCTCCCCAACAGCCCCTCGTGCTGA
BLAST of CmoCh08G002630 vs. Swiss-Prot
Match: DIRL1_ARATH (Putative lipid-transfer protein DIR1 OS=Arabidopsis thaliana GN=DIR1 PE=1 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 1.2e-17 Identity = 49/104 (47.12%), Postives = 67/104 (64.42%), Query Frame = 1
BLAST of CmoCh08G002630 vs. TrEMBL
Match: A0A0A0K4Q7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G372360 PE=4 SV=1) HSP 1 Score: 141.0 bits (354), Expect = 8.4e-31 Identity = 62/95 (65.26%), Postives = 77/95 (81.05%), Query Frame = 1
BLAST of CmoCh08G002630 vs. TrEMBL
Match: A0A022S1B0_ERYGU (Uncharacterized protein (Fragment) OS=Erythranthe guttata GN=MIMGU_mgv1a022331mg PE=4 SV=1) HSP 1 Score: 108.2 bits (269), Expect = 6.0e-21 Identity = 49/77 (63.64%), Postives = 59/77 (76.62%), Query Frame = 1
BLAST of CmoCh08G002630 vs. TrEMBL
Match: A0A022S1I9_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a025642mg PE=4 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 1.1e-19 Identity = 56/98 (57.14%), Postives = 69/98 (70.41%), Query Frame = 1
BLAST of CmoCh08G002630 vs. TrEMBL
Match: A0A164Z5V2_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_018625 PE=4 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 9.6e-19 Identity = 49/96 (51.04%), Postives = 68/96 (70.83%), Query Frame = 1
BLAST of CmoCh08G002630 vs. TrEMBL
Match: A0A059AVL1_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_H00727 PE=4 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 9.6e-19 Identity = 50/96 (52.08%), Postives = 65/96 (67.71%), Query Frame = 1
BLAST of CmoCh08G002630 vs. TAIR10
Match: AT5G48485.1 (AT5G48485.1 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 90.5 bits (223), Expect = 6.6e-19 Identity = 49/104 (47.12%), Postives = 67/104 (64.42%), Query Frame = 1
BLAST of CmoCh08G002630 vs. TAIR10
Match: AT5G48490.1 (AT5G48490.1 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 76.6 bits (187), Expect = 9.8e-15 Identity = 41/101 (40.59%), Postives = 58/101 (57.43%), Query Frame = 1
BLAST of CmoCh08G002630 vs. NCBI nr
Match: gi|700189457|gb|KGN44690.1| (hypothetical protein Csa_7G372360 [Cucumis sativus]) HSP 1 Score: 141.0 bits (354), Expect = 1.2e-30 Identity = 62/95 (65.26%), Postives = 77/95 (81.05%), Query Frame = 1
BLAST of CmoCh08G002630 vs. NCBI nr
Match: gi|778727191|ref|XP_004150334.2| (PREDICTED: putative lipid-transfer protein DIR1 [Cucumis sativus]) HSP 1 Score: 141.0 bits (354), Expect = 1.2e-30 Identity = 62/95 (65.26%), Postives = 77/95 (81.05%), Query Frame = 1
BLAST of CmoCh08G002630 vs. NCBI nr
Match: gi|659092795|ref|XP_008447223.1| (PREDICTED: putative lipid-transfer protein DIR1 [Cucumis melo]) HSP 1 Score: 136.7 bits (343), Expect = 2.3e-29 Identity = 59/95 (62.11%), Postives = 76/95 (80.00%), Query Frame = 1
BLAST of CmoCh08G002630 vs. NCBI nr
Match: gi|848851631|ref|XP_012836760.1| (PREDICTED: putative lipid-transfer protein DIR1 [Erythranthe guttata]) HSP 1 Score: 110.9 bits (276), Expect = 1.3e-21 Identity = 55/88 (62.50%), Postives = 66/88 (75.00%), Query Frame = 1
BLAST of CmoCh08G002630 vs. NCBI nr
Match: gi|604347964|gb|EYU46119.1| (hypothetical protein MIMGU_mgv1a022331mg, partial [Erythranthe guttata]) HSP 1 Score: 108.2 bits (269), Expect = 8.6e-21 Identity = 49/77 (63.64%), Postives = 59/77 (76.62%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|