CmoCh17G012840 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTGATGGTGGTGAGCTTAGCGGAGATGGCGATGGCGGTGGACGTGTGTGGTGTCAACAAGGACGGTCTCAAAGCGTGCAAGCCATGGGTGATGAAACCGTGCCCAACCGAGCTACCGCCCACCGCCTGTTGCGACGGGCTCTCGAAGGCGGACTTGGGTTGCTTTTGCAAGTATAAACACTCCATGTTGCTGTCCTCGCTTGGGATTGATCTTGATCTTGCTCTTGGTTTGCCAGCCAAGTGCAGCCTTCCCAACACTCCCTCTTGCTCTTAA ATGGTGATGGTGGTGAGCTTAGCGGAGATGGCGATGGCGGTGGACGTGTGTGGTGTCAACAAGGACGGTCTCAAAGCGTGCAAGCCATGGGTGATGAAACCGTGCCCAACCGAGCTACCGCCCACCGCCTGTTGCGACGGGCTCTCGAAGGCGGACTTGGGTTGCTTTTGCAAGTATAAACACTCCATGTTGCTGTCCTCGCTTGGGATTGATCTTGATCTTGCTCTTGGTTTGCCAGCCAAGTGCAGCCTTCCCAACACTCCCTCTTGCTCTTAA ATGGTGATGGTGGTGAGCTTAGCGGAGATGGCGATGGCGGTGGACGTGTGTGGTGTCAACAAGGACGGTCTCAAAGCGTGCAAGCCATGGGTGATGAAACCGTGCCCAACCGAGCTACCGCCCACCGCCTGTTGCGACGGGCTCTCGAAGGCGGACTTGGGTTGCTTTTGCAAGTATAAACACTCCATGTTGCTGTCCTCGCTTGGGATTGATCTTGATCTTGCTCTTGGTTTGCCAGCCAAGTGCAGCCTTCCCAACACTCCCTCTTGCTCTTAA
BLAST of CmoCh17G012840 vs. Swiss-Prot
Match: DIRL1_ARATH (Putative lipid-transfer protein DIR1 OS=Arabidopsis thaliana GN=DIR1 PE=1 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 2.1e-15 Identity = 39/90 (43.33%), Postives = 55/90 (61.11%), Query Frame = 1
BLAST of CmoCh17G012840 vs. TrEMBL
Match: A0A0A0K4Q7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G372360 PE=4 SV=1) HSP 1 Score: 138.7 bits (348), Expect = 3.6e-30 Identity = 60/91 (65.93%), Postives = 77/91 (84.62%), Query Frame = 1
BLAST of CmoCh17G012840 vs. TrEMBL
Match: A0A022S1B0_ERYGU (Uncharacterized protein (Fragment) OS=Erythranthe guttata GN=MIMGU_mgv1a022331mg PE=4 SV=1) HSP 1 Score: 99.0 bits (245), Expect = 3.2e-18 Identity = 46/78 (58.97%), Postives = 56/78 (71.79%), Query Frame = 1
BLAST of CmoCh17G012840 vs. TrEMBL
Match: B9SMN5_RICCO (Lipid binding protein, putative OS=Ricinus communis GN=RCOM_1626730 PE=4 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 3.5e-17 Identity = 45/90 (50.00%), Postives = 63/90 (70.00%), Query Frame = 1
BLAST of CmoCh17G012840 vs. TrEMBL
Match: A0A078F1G2_BRANA (BnaC02g38640D protein OS=Brassica napus GN=BnaC02g38640D PE=4 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 6.0e-17 Identity = 45/90 (50.00%), Postives = 61/90 (67.78%), Query Frame = 1
BLAST of CmoCh17G012840 vs. TrEMBL
Match: A0A022S1I9_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a025642mg PE=4 SV=1) HSP 1 Score: 94.0 bits (232), Expect = 1.0e-16 Identity = 51/89 (57.30%), Postives = 61/89 (68.54%), Query Frame = 1
BLAST of CmoCh17G012840 vs. TAIR10
Match: AT5G48485.1 (AT5G48485.1 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 82.8 bits (203), Expect = 1.2e-16 Identity = 39/90 (43.33%), Postives = 55/90 (61.11%), Query Frame = 1
BLAST of CmoCh17G012840 vs. TAIR10
Match: AT5G48490.1 (AT5G48490.1 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 76.3 bits (186), Expect = 1.1e-14 Identity = 39/90 (43.33%), Postives = 51/90 (56.67%), Query Frame = 1
BLAST of CmoCh17G012840 vs. NCBI nr
Match: gi|700189457|gb|KGN44690.1| (hypothetical protein Csa_7G372360 [Cucumis sativus]) HSP 1 Score: 138.7 bits (348), Expect = 5.2e-30 Identity = 60/91 (65.93%), Postives = 77/91 (84.62%), Query Frame = 1
BLAST of CmoCh17G012840 vs. NCBI nr
Match: gi|778727191|ref|XP_004150334.2| (PREDICTED: putative lipid-transfer protein DIR1 [Cucumis sativus]) HSP 1 Score: 138.7 bits (348), Expect = 5.2e-30 Identity = 60/91 (65.93%), Postives = 77/91 (84.62%), Query Frame = 1
BLAST of CmoCh17G012840 vs. NCBI nr
Match: gi|659092795|ref|XP_008447223.1| (PREDICTED: putative lipid-transfer protein DIR1 [Cucumis melo]) HSP 1 Score: 133.7 bits (335), Expect = 1.7e-28 Identity = 57/91 (62.64%), Postives = 76/91 (83.52%), Query Frame = 1
BLAST of CmoCh17G012840 vs. NCBI nr
Match: gi|848851631|ref|XP_012836760.1| (PREDICTED: putative lipid-transfer protein DIR1 [Erythranthe guttata]) HSP 1 Score: 99.4 bits (246), Expect = 3.5e-18 Identity = 51/88 (57.95%), Postives = 61/88 (69.32%), Query Frame = 1
BLAST of CmoCh17G012840 vs. NCBI nr
Match: gi|604347964|gb|EYU46119.1| (hypothetical protein MIMGU_mgv1a022331mg, partial [Erythranthe guttata]) HSP 1 Score: 99.0 bits (245), Expect = 4.6e-18 Identity = 46/78 (58.97%), Postives = 56/78 (71.79%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|