CmoCh04G029610 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCGGATAGCTCGCAACAGATGAGCTTTCAGGCTGGAGAGGCCAAGGGCCAAGCTAAGGAGAAGACAAGCAATTTGATTGAGAAAGCTAGCAATGCAGCTCAATCAGCGAAGGAGACCGTGCAAGAGGCCGGCCAACAGATGGTGGCTAGGGCTCAAGGAGCTGCCGAGGCTGTGAAGGATGCCACCGGATTGAACAAATGA ATGGCGGATAGCTCGCAACAGATGAGCTTTCAGGCTGGAGAGGCCAAGGGCCAAGCTAAGGAGAAGACAAGCAATTTGATTGAGAAAGCTAGCAATGCAGCTCAATCAGCGAAGGAGACCGTGCAAGAGGCCGGCCAACAGATGGTGGCTAGGGCTCAAGGAGCTGCCGAGGCTGTGAAGGATGCCACCGGATTGAACAAATGA ATGGCGGATAGCTCGCAACAGATGAGCTTTCAGGCTGGAGAGGCCAAGGGCCAAGCTAAGGAGAAGACAAGCAATTTGATTGAGAAAGCTAGCAATGCAGCTCAATCAGCGAAGGAGACCGTGCAAGAGGCCGGCCAACAGATGGTGGCTAGGGCTCAAGGAGCTGCCGAGGCTGTGAAGGATGCCACCGGATTGAACAAATGA
BLAST of CmoCh04G029610 vs. TrEMBL
Match: A0A0A0KVV6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G643260 PE=4 SV=1) HSP 1 Score: 97.4 bits (241), Expect = 6.8e-18 Identity = 52/67 (77.61%), Postives = 64/67 (95.52%), Query Frame = 1
BLAST of CmoCh04G029610 vs. TrEMBL
Match: A0A0A0KPD4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G165870 PE=4 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 9.9e-17 Identity = 51/67 (76.12%), Postives = 62/67 (92.54%), Query Frame = 1
BLAST of CmoCh04G029610 vs. TrEMBL
Match: W9RDZ1_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_009672 PE=4 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 4.9e-16 Identity = 50/67 (74.63%), Postives = 61/67 (91.04%), Query Frame = 1
BLAST of CmoCh04G029610 vs. TrEMBL
Match: A0A0A0KRE1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G165860 PE=4 SV=1) HSP 1 Score: 88.2 bits (217), Expect = 4.1e-15 Identity = 48/67 (71.64%), Postives = 61/67 (91.04%), Query Frame = 1
BLAST of CmoCh04G029610 vs. TrEMBL
Match: U5FMZ3_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0017s14330g PE=4 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 5.4e-15 Identity = 48/67 (71.64%), Postives = 61/67 (91.04%), Query Frame = 1
BLAST of CmoCh04G029610 vs. TAIR10
Match: AT5G53820.1 (AT5G53820.1 Late embryogenesis abundant protein (LEA) family protein) HSP 1 Score: 81.3 bits (199), Expect = 2.6e-16 Identity = 43/67 (64.18%), Postives = 58/67 (86.57%), Query Frame = 1
BLAST of CmoCh04G029610 vs. TAIR10
Match: AT5G38760.1 (AT5G38760.1 Late embryogenesis abundant protein (LEA) family protein) HSP 1 Score: 78.2 bits (191), Expect = 2.2e-15 Identity = 42/67 (62.69%), Postives = 58/67 (86.57%), Query Frame = 1
BLAST of CmoCh04G029610 vs. TAIR10
Match: AT3G02480.1 (AT3G02480.1 Late embryogenesis abundant protein (LEA) family protein) HSP 1 Score: 66.2 bits (160), Expect = 8.5e-12 Identity = 35/65 (53.85%), Postives = 50/65 (76.92%), Query Frame = 1
BLAST of CmoCh04G029610 vs. TAIR10
Match: AT5G15970.1 (AT5G15970.1 stress-responsive protein (KIN2) / stress-induced protein (KIN2) / cold-responsive protein (COR6.6) / cold-regulated protein (COR6.6)) HSP 1 Score: 47.0 bits (110), Expect = 5.4e-06 Identity = 28/59 (47.46%), Postives = 42/59 (71.19%), Query Frame = 1
BLAST of CmoCh04G029610 vs. NCBI nr
Match: gi|659119050|ref|XP_008459448.1| (PREDICTED: stress-induced protein KIN2-like [Cucumis melo]) HSP 1 Score: 102.4 bits (254), Expect = 3.0e-19 Identity = 55/67 (82.09%), Postives = 66/67 (98.51%), Query Frame = 1
BLAST of CmoCh04G029610 vs. NCBI nr
Match: gi|449447460|ref|XP_004141486.1| (PREDICTED: late embryogenesis abundant protein 2-like [Cucumis sativus]) HSP 1 Score: 97.4 bits (241), Expect = 9.8e-18 Identity = 52/67 (77.61%), Postives = 64/67 (95.52%), Query Frame = 1
BLAST of CmoCh04G029610 vs. NCBI nr
Match: gi|449469355|ref|XP_004152386.1| (PREDICTED: stress-induced protein KIN2-like [Cucumis sativus]) HSP 1 Score: 93.6 bits (231), Expect = 1.4e-16 Identity = 51/67 (76.12%), Postives = 62/67 (92.54%), Query Frame = 1
BLAST of CmoCh04G029610 vs. NCBI nr
Match: gi|703115476|ref|XP_010100902.1| (hypothetical protein L484_009672 [Morus notabilis]) HSP 1 Score: 91.3 bits (225), Expect = 7.0e-16 Identity = 50/67 (74.63%), Postives = 61/67 (91.04%), Query Frame = 1
BLAST of CmoCh04G029610 vs. NCBI nr
Match: gi|659073373|ref|XP_008437025.1| (PREDICTED: stress-induced protein KIN2-like [Cucumis melo]) HSP 1 Score: 90.5 bits (223), Expect = 1.2e-15 Identity = 49/67 (73.13%), Postives = 62/67 (92.54%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene: |