CmoCh04G016540 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAATATTACAATTGTGATGAGACCAGAGGGATTGCGAAGGTGAAGTGGCAGAGGAGAGGGAGGCGCGGCGGACGGCACGGCGGCGCCTCCGTTCACATGAAGTTGAGAAAGCTGCAGCGAATCATCCCCGGAGGACGGAGGCTGAAACCGGACCGGCTATTCTTAAAAACGGCGGATTATATTATGCAATTGAGGTCTCAAGTTCATGTTTTGAACGCGCTTTCCAAGATCTACGACCCCCAACTTTCTCGATATTGA ATGGAATATTACAATTGTGATGAGACCAGAGGGATTGCGAAGGTGAAGTGGCAGAGGAGAGGGAGGCGCGGCGGACGGCACGGCGGCGCCTCCGTTCACATGAAGTTGAGAAAGCTGCAGCGAATCATCCCCGGAGGACGGAGGCTGAAACCGGACCGGCTATTCTTAAAAACGGCGGATTATATTATGCAATTGAGGTCTCAAGTTCATGTTTTGAACGCGCTTTCCAAGATCTACGACCCCCAACTTTCTCGATATTGA ATGGAATATTACAATTGTGATGAGACCAGAGGGATTGCGAAGGTGAAGTGGCAGAGGAGAGGGAGGCGCGGCGGACGGCACGGCGGCGCCTCCGTTCACATGAAGTTGAGAAAGCTGCAGCGAATCATCCCCGGAGGACGGAGGCTGAAACCGGACCGGCTATTCTTAAAAACGGCGGATTATATTATGCAATTGAGGTCTCAAGTTCATGTTTTGAACGCGCTTTCCAAGATCTACGACCCCCAACTTTCTCGATATTGA
BLAST of CmoCh04G016540 vs. TrEMBL
Match: A0A0A0KQB4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G602220 PE=4 SV=1) HSP 1 Score: 144.8 bits (364), Expect = 4.8e-32 Identity = 71/88 (80.68%), Postives = 78/88 (88.64%), Query Frame = 1
BLAST of CmoCh04G016540 vs. TrEMBL
Match: A0A0D2UY55_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_009G343700 PE=4 SV=1) HSP 1 Score: 89.7 bits (221), Expect = 1.8e-15 Identity = 48/86 (55.81%), Postives = 59/86 (68.60%), Query Frame = 1
BLAST of CmoCh04G016540 vs. TrEMBL
Match: A0A0D2SJD6_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G184100 PE=4 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 2.6e-14 Identity = 42/74 (56.76%), Postives = 57/74 (77.03%), Query Frame = 1
BLAST of CmoCh04G016540 vs. TrEMBL
Match: A0A067GSA5_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g037825mg PE=4 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 1.0e-13 Identity = 44/71 (61.97%), Postives = 55/71 (77.46%), Query Frame = 1
BLAST of CmoCh04G016540 vs. TrEMBL
Match: B9S4M3_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_0993530 PE=4 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 7.2e-12 Identity = 43/80 (53.75%), Postives = 56/80 (70.00%), Query Frame = 1
BLAST of CmoCh04G016540 vs. TAIR10
Match: AT1G23965.1 (AT1G23965.1 unknown protein) HSP 1 Score: 60.8 bits (146), Expect = 4.6e-10 Identity = 33/74 (44.59%), Postives = 48/74 (64.86%), Query Frame = 1
BLAST of CmoCh04G016540 vs. NCBI nr
Match: gi|778705118|ref|XP_011655641.1| (PREDICTED: transcription factor PAR2 [Cucumis sativus]) HSP 1 Score: 144.8 bits (364), Expect = 6.9e-32 Identity = 71/88 (80.68%), Postives = 78/88 (88.64%), Query Frame = 1
BLAST of CmoCh04G016540 vs. NCBI nr
Match: gi|659090850|ref|XP_008446236.1| (PREDICTED: uncharacterized protein LOC103489026 [Cucumis melo]) HSP 1 Score: 139.8 bits (351), Expect = 2.2e-30 Identity = 70/87 (80.46%), Postives = 75/87 (86.21%), Query Frame = 1
BLAST of CmoCh04G016540 vs. NCBI nr
Match: gi|802788017|ref|XP_012092068.1| (PREDICTED: transcription factor PAR1 [Jatropha curcas]) HSP 1 Score: 92.0 bits (227), Expect = 5.3e-16 Identity = 48/77 (62.34%), Postives = 59/77 (76.62%), Query Frame = 1
BLAST of CmoCh04G016540 vs. NCBI nr
Match: gi|823216320|ref|XP_012440878.1| (PREDICTED: transcription factor PAR1-like [Gossypium raimondii]) HSP 1 Score: 89.7 bits (221), Expect = 2.6e-15 Identity = 48/86 (55.81%), Postives = 59/86 (68.60%), Query Frame = 1
BLAST of CmoCh04G016540 vs. NCBI nr
Match: gi|823159182|ref|XP_012479422.1| (PREDICTED: transcription factor PAR1-like [Gossypium raimondii]) HSP 1 Score: 85.9 bits (211), Expect = 3.8e-14 Identity = 42/74 (56.76%), Postives = 57/74 (77.03%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|