Cla021548 (gene) Watermelon (97103) v1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGGCGATGCAGAGAGAAAAAGCCAGTGCCAAGCGCCGACACGGCTGCAGAGCCAGGCTCCGGCATCGATTGAGATAAAGCGGGCGCCGAATTGGAACATGGCCATACCCTTGTTATCCCCTCTTGTATCACCTTCGTCTTGTGGGAATCCAGGGCAAGAGGAAGCCTTGTTGATGGCTGAGAATAAAGCGAGGGAGGAAGCCAAAGGGCTAAGCTTTACCAAATGGCAGCACCCTGCGGCTCCATTTTATTATGGGCCAGTCCCAAGGGCCACCCCCTTTGTGCCCGTGTGA ATGGGCGATGCAGAGAGAAAAAGCCAGTGCCAAGCGCCGACACGGCTGCAGAGCCAGGCTCCGGCATCGATTGAGATAAAGCGGGCGCCGAATTGGAACATGGCCATACCCTTGTTATCCCCTCTTGTATCACCTTCGTCTTGTGGGAATCCAGGGCAAGAGGAAGCCTTGTTGATGGCTGAGAATAAAGCGAGGGAGGAAGCCAAAGGGCTAAGCTTTACCAAATGGCAGCACCCTGCGGCTCCATTTTATTATGGGCCAGTCCCAAGGGCCACCCCCTTTGTGCCCGTGTGA ATGGGCGATGCAGAGAGAAAAAGCCAGTGCCAAGCGCCGACACGGCTGCAGAGCCAGGCTCCGGCATCGATTGAGATAAAGCGGGCGCCGAATTGGAACATGGCCATACCCTTGTTATCCCCTCTTGTATCACCTTCGTCTTGTGGGAATCCAGGGCAAGAGGAAGCCTTGTTGATGGCTGAGAATAAAGCGAGGGAGGAAGCCAAAGGGCTAAGCTTTACCAAATGGCAGCACCCTGCGGCTCCATTTTATTATGGGCCAGTCCCAAGGGCCACCCCCTTTGTGCCCGTGTGA MGDAERKSQCQAPTRLQSQAPASIEIKRAPNWNMAIPLLSPLVSPSSCGNPGQEEALLMAENKAREEAKGLSFTKWQHPAAPFYYGPVPRATPFVPV
BLAST of Cla021548 vs. Swiss-Prot
Match: Y4445_ARATH (Uncharacterized protein At4g14450, chloroplastic OS=Arabidopsis thaliana GN=At4g14450 PE=2 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 3.9e-07 Identity = 36/92 (39.13%), Postives = 48/92 (52.17%), Query Frame = 1
BLAST of Cla021548 vs. TrEMBL
Match: A0A0A0L8D3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G141830 PE=4 SV=1) HSP 1 Score: 158.3 bits (399), Expect = 4.7e-36 Identity = 79/98 (80.61%), Postives = 83/98 (84.69%), Query Frame = 1
BLAST of Cla021548 vs. TrEMBL
Match: I1NI17_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_20G202600 PE=4 SV=1) HSP 1 Score: 86.3 bits (212), Expect = 2.3e-14 Identity = 48/98 (48.98%), Postives = 59/98 (60.20%), Query Frame = 1
BLAST of Cla021548 vs. TrEMBL
Match: I1LCD2_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_10G188200 PE=4 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 5.1e-14 Identity = 47/98 (47.96%), Postives = 58/98 (59.18%), Query Frame = 1
BLAST of Cla021548 vs. TrEMBL
Match: M5XT20_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa013660mg PE=4 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 3.3e-13 Identity = 49/110 (44.55%), Postives = 65/110 (59.09%), Query Frame = 1
BLAST of Cla021548 vs. TrEMBL
Match: V7BGS6_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_007G129100g PE=4 SV=1) HSP 1 Score: 80.5 bits (197), Expect = 1.3e-12 Identity = 45/98 (45.92%), Postives = 58/98 (59.18%), Query Frame = 1
BLAST of Cla021548 vs. NCBI nr
Match: gi|700201754|gb|KGN56887.1| (hypothetical protein Csa_3G141830 [Cucumis sativus]) HSP 1 Score: 158.3 bits (399), Expect = 6.8e-36 Identity = 79/98 (80.61%), Postives = 83/98 (84.69%), Query Frame = 1
BLAST of Cla021548 vs. NCBI nr
Match: gi|571569255|ref|XP_006606361.1| (PREDICTED: uncharacterized protein At4g14450, chloroplastic-like [Glycine max]) HSP 1 Score: 86.3 bits (212), Expect = 3.3e-14 Identity = 48/98 (48.98%), Postives = 59/98 (60.20%), Query Frame = 1
BLAST of Cla021548 vs. NCBI nr
Match: gi|1012240624|ref|XP_015940792.1| (PREDICTED: uncharacterized protein At4g14450, chloroplastic-like [Arachis duranensis]) HSP 1 Score: 85.5 bits (210), Expect = 5.6e-14 Identity = 42/89 (47.19%), Postives = 57/89 (64.04%), Query Frame = 1
BLAST of Cla021548 vs. NCBI nr
Match: gi|571483637|ref|XP_006589298.1| (PREDICTED: uncharacterized protein At4g14450, chloroplastic-like [Glycine max]) HSP 1 Score: 85.1 bits (209), Expect = 7.3e-14 Identity = 47/98 (47.96%), Postives = 58/98 (59.18%), Query Frame = 1
BLAST of Cla021548 vs. NCBI nr
Match: gi|1009141024|ref|XP_015887969.1| (PREDICTED: uncharacterized protein At4g14450, chloroplastic [Ziziphus jujuba]) HSP 1 Score: 84.7 bits (208), Expect = 9.5e-14 Identity = 49/102 (48.04%), Postives = 61/102 (59.80%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
This gene is associated with the following unigenes:
The following mRNA feature(s) are a part of this gene:
The following transcribed_cluster feature(s) are associated with this gene:
Analysis Name: InterPro Annotations of watermelon (97103)
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |