![](http://cucurbitgenomics.org/sites/default/files/styles/slideshow/public/carousel/101322_web.jpg?itok=EG-G51x6)
MELO3C020729.jh1.t1 (mRNA) Melon (Harukei-3) v1.41
Overview
Sequences
The following sequences are available for this feature:
Legend: polypeptideexonCDSstart_codonstop_codon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTTGATACAAAGTCTACAATAGCTAAAGATGTTACTGAAGTGAGCCATTGACCTTCCTCCCTCTCTTTTTCCTCAATTGAATTTCAAGGATTGACTTAGCTTATTATCAAGAACTTTTGAATTTCATTACATTCATTTTTCATATATTAAAATTTTCAGCTAATTGAGAATACACCACTTGTATATCTCAACCGTGCTATTAATGGTTGCGTGGCTCGGGTAGCTGCCAAGTTGGATATGATGGAGCCTTGCTCTAGTGTCAAAGATAGGTACTTTTTATTTTTAATTATAGTTTTTTTAAAATAA ATGGTTGATACAAAGTCTACAATAGCTAAAGATGTTACTGAACTAATTGAGAATACACCACTTGTATATCTCAACCGTGCTATTAATGGTTGCGTGGCTCGGGTAGCTGCCAAGTTGGATATGATGGAGCCTTGCTCTAGTGTCAAAGATAGGTACTTTTTATTTTTAATTATAGTTTTTTTAAAATAA ATGGTTGATACAAAGTCTACAATAGCTAAAGATGTTACTGAACTAATTGAGAATACACCACTTGTATATCTCAACCGTGCTATTAATGGTTGCGTGGCTCGGGTAGCTGCCAAGTTGGATATGATGGAGCCTTGCTCTAGTGTCAAAGATAGGTACTTTTTATTTTTAATTATAGTTTTTTTAAAATAA MVDTKSTIAKDVTELIENTPLVYLNRAINGCVARVAAKLDMMEPCSSVKDRYFLFLIIVFLK Homology
BLAST of MELO3C020729.jh1.t1 vs. NCBI nr
Match: XP_008455731.1 (PREDICTED: cysteine synthase isoform X2 [Cucumis melo] >XP_008455734.1 PREDICTED: cysteine synthase isoform X2 [Cucumis melo] >ADN33908.1 cysteine synthase [Cucumis melo subsp. melo]) HSP 1 Score: 94.7 bits (234), Expect = 2.28e-21 Identity = 46/51 (90.20%), Postives = 49/51 (96.08%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. NCBI nr
Match: XP_008455725.2 (PREDICTED: cysteine synthase isoform X1 [Cucumis melo]) HSP 1 Score: 94.7 bits (234), Expect = 2.93e-21 Identity = 46/51 (90.20%), Postives = 49/51 (96.08%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. NCBI nr
Match: XP_038890826.1 (cysteine synthase [Benincasa hispida] >XP_038890827.1 cysteine synthase [Benincasa hispida] >XP_038890828.1 cysteine synthase [Benincasa hispida]) HSP 1 Score: 92.8 bits (229), Expect = 1.21e-20 Identity = 45/51 (88.24%), Postives = 48/51 (94.12%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. NCBI nr
Match: Q43317.1 (RecName: Full=Cysteine synthase; Short=CSase; AltName: Full=Beta-PA/CSase; AltName: Full=Beta-pyrazolylalanine synthase; AltName: Full=L-mimosine synthase; AltName: Full=O-acetylserine (thiol)-lyase; Short=OAS-TL; AltName: Full=O-acetylserine sulfhydrylase [Citrullus lanatus] >BAA05965.1 cysteine synthase [Citrullus lanatus subsp. vulgaris]) HSP 1 Score: 91.3 bits (225), Expect = 4.60e-20 Identity = 44/51 (86.27%), Postives = 47/51 (92.16%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. NCBI nr
Match: XP_023538275.1 (cysteine synthase-like [Cucurbita pepo subsp. pepo] >XP_023538276.1 cysteine synthase-like [Cucurbita pepo subsp. pepo] >XP_023538277.1 cysteine synthase-like [Cucurbita pepo subsp. pepo]) HSP 1 Score: 89.0 bits (219), Expect = 3.39e-19 Identity = 43/51 (84.31%), Postives = 47/51 (92.16%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. ExPASy Swiss-Prot
Match: Q43317 (Cysteine synthase OS=Citrullus lanatus OX=3654 PE=1 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 3.2e-18 Identity = 44/51 (86.27%), Postives = 47/51 (92.16%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. ExPASy Swiss-Prot
Match: O81154 (Cysteine synthase OS=Solanum tuberosum OX=4113 PE=2 SV=1) HSP 1 Score: 79.3 bits (194), Expect = 1.7e-14 Identity = 39/51 (76.47%), Postives = 42/51 (82.35%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. ExPASy Swiss-Prot
Match: Q9XEA6 (Cysteine synthase OS=Oryza sativa subsp. japonica OX=39947 GN=RCS1 PE=2 SV=2) HSP 1 Score: 79.0 bits (193), Expect = 2.2e-14 Identity = 38/45 (84.44%), Postives = 40/45 (88.89%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. ExPASy Swiss-Prot
Match: P47998 (Cysteine synthase 1 OS=Arabidopsis thaliana OX=3702 GN=OASA1 PE=1 SV=2) HSP 1 Score: 78.2 bits (191), Expect = 3.7e-14 Identity = 38/46 (82.61%), Postives = 39/46 (84.78%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. ExPASy Swiss-Prot
Match: O23733 (Cysteine synthase OS=Brassica juncea OX=3707 PE=2 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 3.7e-14 Identity = 38/46 (82.61%), Postives = 39/46 (84.78%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. ExPASy TrEMBL
Match: A0A1S3C157 (Cysteine synthase OS=Cucumis melo OX=3656 GN=LOC103495826 PE=3 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 1.10e-21 Identity = 46/51 (90.20%), Postives = 49/51 (96.08%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. ExPASy TrEMBL
Match: E5GBR6 (Cysteine synthase OS=Cucumis melo subsp. melo OX=412675 PE=3 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 1.10e-21 Identity = 46/51 (90.20%), Postives = 49/51 (96.08%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. ExPASy TrEMBL
Match: A0A1S3C1N8 (Cysteine synthase OS=Cucumis melo OX=3656 GN=LOC103495826 PE=3 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 1.42e-21 Identity = 46/51 (90.20%), Postives = 49/51 (96.08%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. ExPASy TrEMBL
Match: A0A6J1HPW0 (Cysteine synthase OS=Cucurbita maxima OX=3661 GN=LOC111465603 PE=3 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 1.64e-19 Identity = 43/51 (84.31%), Postives = 47/51 (92.16%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. ExPASy TrEMBL
Match: A0A6J1FB21 (Cysteine synthase OS=Cucurbita moschata OX=3662 GN=LOC111444010 PE=3 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 1.64e-19 Identity = 43/51 (84.31%), Postives = 47/51 (92.16%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. TAIR 10
Match: AT4G14880.1 (O-acetylserine (thiol) lyase (OAS-TL) isoform A1 ) HSP 1 Score: 78.2 bits (191), Expect = 2.6e-15 Identity = 38/46 (82.61%), Postives = 39/46 (84.78%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. TAIR 10
Match: AT4G14880.2 (O-acetylserine (thiol) lyase (OAS-TL) isoform A1 ) HSP 1 Score: 78.2 bits (191), Expect = 2.6e-15 Identity = 38/46 (82.61%), Postives = 39/46 (84.78%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. TAIR 10
Match: AT4G14880.3 (O-acetylserine (thiol) lyase (OAS-TL) isoform A1 ) HSP 1 Score: 78.2 bits (191), Expect = 2.6e-15 Identity = 38/46 (82.61%), Postives = 39/46 (84.78%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. TAIR 10
Match: AT4G14880.4 (O-acetylserine (thiol) lyase (OAS-TL) isoform A1 ) HSP 1 Score: 78.2 bits (191), Expect = 2.6e-15 Identity = 38/46 (82.61%), Postives = 39/46 (84.78%), Query Frame = 0
BLAST of MELO3C020729.jh1.t1 vs. TAIR 10
Match: AT5G28020.1 (cysteine synthase D2 ) HSP 1 Score: 75.5 bits (184), Expect = 1.7e-14 Identity = 33/50 (66.00%), Postives = 42/50 (84.00%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Melon (Harukei-3) v1.41
Date Performed: 2021-10-25
Relationships
This mRNA is a part of the following gene feature(s):
The following exon feature(s) are a part of this mRNA:
The following stop_codon feature(s) are a part of this mRNA:
The following CDS feature(s) are a part of this mRNA:
The following start_codon feature(s) are a part of this mRNA:
The following polypeptide feature(s) derives from this mRNA:
|