IVF0013043.1 (mRNA) Melon (IVF77) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTCCTCAAGTATCAGTTGGTTCTTGAAGATCTAGATGTTTTAGTCTCTGTAAGGTCTGATGAGGATTTAAAGCATAGGCTTGATGAGTATGATTGCCTAGAAAGTGAAGGAAAGCTTCAATGTTTCTTATTTCCTTCAAATCCAATTTTCATTAAGGCTCAGCCATTCTCCTCAAATCCCCAGCAAATCGAGCAACGTTATTTTGAAGCTATCAATGGCATTGTATGGTCTGGCTCCTTTGCCAATGTAAAACTCTCCCGTAGTACCGCTAACTGA ATGGTCCTCAAGTATCAGTTGGTTCTTGAAGATCTAGATGTTTTAGTCTCTGTAAGGTCTGATGAGGATTTAAAGCATAGGCTTGATGAGTATGATTGCCTAGAAAGTGAAGGAAAGCTTCAATGTTTCTTATTTCCTTCAAATCCAATTTTCATTAAGGCTCAGCCATTCTCCTCAAATCCCCAGCAAATCGAGCAACGTTATTTTGAAGCTATCAATGGCATTGTATGGTCTGGCTCCTTTGCCAATGTAAAACTCTCCCGTAGTACCGCTAACTGA ATGGTCCTCAAGTATCAGTTGGTTCTTGAAGATCTAGATGTTTTAGTCTCTGTAAGGTCTGATGAGGATTTAAAGCATAGGCTTGATGAGTATGATTGCCTAGAAAGTGAAGGAAAGCTTCAATGTTTCTTATTTCCTTCAAATCCAATTTTCATTAAGGCTCAGCCATTCTCCTCAAATCCCCAGCAAATCGAGCAACGTTATTTTGAAGCTATCAATGGCATTGTATGGTCTGGCTCCTTTGCCAATGTAAAACTCTCCCGTAGTACCGCTAACTGA MVLKYQLVLEDLDVLVSVRSDEDLKHRLDEYDCLESEGKLQCFLFPSNPIFIKAQPFSSNPQQIEQRYFEAINGIVWSGSFANVKLSRSTAN Homology
BLAST of IVF0013043.1 vs. ExPASy TrEMBL
Match: A0A5D3E246 (Octicosapeptide/Phox/Bem1p domain-containing family protein OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold588G00090 PE=4 SV=1) HSP 1 Score: 186.8 bits (473), Expect = 4.0e-44 Identity = 92/92 (100.00%), Postives = 92/92 (100.00%), Query Frame = 0
BLAST of IVF0013043.1 vs. ExPASy TrEMBL
Match: A0A5A7UL31 (Octicosapeptide/Phox/Bem1p domain-containing family protein OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold106G00210 PE=4 SV=1) HSP 1 Score: 181.0 bits (458), Expect = 2.2e-42 Identity = 88/92 (95.65%), Postives = 90/92 (97.83%), Query Frame = 0
BLAST of IVF0013043.1 vs. ExPASy TrEMBL
Match: A0A5A7U7T5 (PB1 domain-containing protein OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold60G002390 PE=4 SV=1) HSP 1 Score: 180.6 bits (457), Expect = 2.9e-42 Identity = 89/92 (96.74%), Postives = 90/92 (97.83%), Query Frame = 0
BLAST of IVF0013043.1 vs. ExPASy TrEMBL
Match: A0A5A7T2V3 (Octicosapeptide/Phox/Bem1p domain-containing family protein OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold918G00140 PE=4 SV=1) HSP 1 Score: 171.4 bits (433), Expect = 1.8e-39 Identity = 88/92 (95.65%), Postives = 88/92 (95.65%), Query Frame = 0
BLAST of IVF0013043.1 vs. ExPASy TrEMBL
Match: A0A5A7T3H0 (Tub domain-containing protein OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold36G00470 PE=3 SV=1) HSP 1 Score: 153.3 bits (386), Expect = 4.9e-34 Identity = 72/75 (96.00%), Postives = 74/75 (98.67%), Query Frame = 0
BLAST of IVF0013043.1 vs. NCBI nr
Match: KAA0053093.1 (octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa] >KAA0065720.1 octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa] >TYK29946.1 octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa]) HSP 1 Score: 185 bits (470), Expect = 5.04e-59 Identity = 92/92 (100.00%), Postives = 92/92 (100.00%), Query Frame = 0
BLAST of IVF0013043.1 vs. NCBI nr
Match: KAA0056522.1 (octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa] >TYK12092.1 octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa]) HSP 1 Score: 179 bits (455), Expect = 9.81e-57 Identity = 88/92 (95.65%), Postives = 90/92 (97.83%), Query Frame = 0
BLAST of IVF0013043.1 vs. NCBI nr
Match: KAA0051822.1 (hypothetical protein E6C27_scaffold60G002390 [Cucumis melo var. makuwa]) HSP 1 Score: 179 bits (454), Expect = 1.39e-56 Identity = 89/92 (96.74%), Postives = 90/92 (97.83%), Query Frame = 0
BLAST of IVF0013043.1 vs. NCBI nr
Match: KAA0037802.1 (octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa]) HSP 1 Score: 170 bits (430), Expect = 6.40e-53 Identity = 88/92 (95.65%), Postives = 88/92 (95.65%), Query Frame = 0
BLAST of IVF0013043.1 vs. NCBI nr
Match: KAA0037880.1 (uncharacterized protein E6C27_scaffold36G00470 [Cucumis melo var. makuwa]) HSP 1 Score: 152 bits (384), Expect = 8.58e-45 Identity = 72/75 (96.00%), Postives = 74/75 (98.67%), Query Frame = 0
BLAST of IVF0013043.1 vs. TAIR 10
Match: AT5G49920.1 (Octicosapeptide/Phox/Bem1p family protein ) HSP 1 Score: 89.0 bits (219), Expect = 2.2e-18 Identity = 44/76 (57.89%), Postives = 60/76 (78.95%), Query Frame = 0
BLAST of IVF0013043.1 vs. TAIR 10
Match: AT1G79570.1 (Protein kinase superfamily protein with octicosapeptide/Phox/Bem1p domain ) HSP 1 Score: 56.2 bits (134), Expect = 1.6e-08 Identity = 39/96 (40.62%), Postives = 58/96 (60.42%), Query Frame = 0
BLAST of IVF0013043.1 vs. TAIR 10
Match: AT3G46920.1 (Protein kinase superfamily protein with octicosapeptide/Phox/Bem1p domain ) HSP 1 Score: 53.1 bits (126), Expect = 1.3e-07 Identity = 35/87 (40.23%), Postives = 51/87 (58.62%), Query Frame = 0
BLAST of IVF0013043.1 vs. TAIR 10
Match: AT5G09620.1 (Octicosapeptide/Phox/Bem1p family protein ) HSP 1 Score: 52.8 bits (125), Expect = 1.7e-07 Identity = 27/51 (52.94%), Postives = 35/51 (68.63%), Query Frame = 0
BLAST of IVF0013043.1 vs. TAIR 10
Match: AT5G64430.1 (Octicosapeptide/Phox/Bem1p family protein ) HSP 1 Score: 52.0 bits (123), Expect = 3.0e-07 Identity = 30/79 (37.97%), Postives = 45/79 (56.96%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Melon (IVF77) v1
Date Performed: 2021-10-25
Relationships
This mRNA is a part of the following gene feature(s):
The following exon feature(s) are a part of this mRNA:
The following CDS feature(s) are a part of this mRNA:
The following polypeptide feature(s) derives from this mRNA:
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
|