CcUC07G138240.1 (mRNA) Watermelon (PI 537277) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAAGCAACTCATTCAACTAGGGTTGTGATTATTGACACCAAGTATGTACAAACGGATGCCAAGAGCTTCAAAACGGTGGTGCAAAAGCTGACGGGGAAAGATCCGGTAGCCGCAGTGGGGGAGGAGAACCGACATACCTGCAGCGCCCGGAACTCGGGTCTTTTGAGAGAATCATCGTTCAAGGAGTTCCAGAGAGTGCTGAGAGAGATGCCAAGAATTGATGAGCTTTATTCTGATTGA ATGGAAGCAACTCATTCAACTAGGGTTGTGATTATTGACACCAAGTATGTACAAACGGATGCCAAGAGCTTCAAAACGGTGGTGCAAAAGCTGACGGGGAAAGATCCGGTAGCCGCAGTGGGGGAGGAGAACCGACATACCTGCAGCGCCCGGAACTCGGGTCTTTTGAGAGAATCATCGTTCAAGGAGTTCCAGAGAGTGCTGAGAGAGATGCCAAGAATTGATGAGCTTTATTCTGATTGA ATGGAAGCAACTCATTCAACTAGGGTTGTGATTATTGACACCAAGTATGTACAAACGGATGCCAAGAGCTTCAAAACGGTGGTGCAAAAGCTGACGGGGAAAGATCCGGTAGCCGCAGTGGGGGAGGAGAACCGACATACCTGCAGCGCCCGGAACTCGGGTCTTTTGAGAGAATCATCGTTCAAGGAGTTCCAGAGAGTGCTGAGAGAGATGCCAAGAATTGATGAGCTTTATTCTGATTGA MEATHSTRVVIIDTKYVQTDAKSFKTVVQKLTGKDPVAAVGEENRHTCSARNSGLLRESSFKEFQRVLREMPRIDELYSD Homology
BLAST of CcUC07G138240.1 vs. NCBI nr
Match: KAA0063001.1 (VQ motif-containing protein 1-like [Cucumis melo var. makuwa] >TYK16346.1 VQ motif-containing protein 1-like [Cucumis melo var. makuwa]) HSP 1 Score: 134.8 bits (338), Expect = 3.3e-28 Identity = 73/81 (90.12%), Postives = 74/81 (91.36%), Query Frame = 0
BLAST of CcUC07G138240.1 vs. NCBI nr
Match: XP_038889427.1 (VQ motif-containing protein 1-like [Benincasa hispida]) HSP 1 Score: 132.9 bits (333), Expect = 1.2e-27 Identity = 71/80 (88.75%), Postives = 72/80 (90.00%), Query Frame = 0
BLAST of CcUC07G138240.1 vs. NCBI nr
Match: KGN53544.1 (hypothetical protein Csa_014778 [Cucumis sativus]) HSP 1 Score: 128.6 bits (322), Expect = 2.3e-26 Identity = 70/81 (86.42%), Postives = 71/81 (87.65%), Query Frame = 0
BLAST of CcUC07G138240.1 vs. NCBI nr
Match: KAG6577059.1 (VQ motif-containing protein 1, partial [Cucurbita argyrosperma subsp. sororia] >KAG7015070.1 VQ motif-containing protein 1, partial [Cucurbita argyrosperma subsp. argyrosperma]) HSP 1 Score: 116.3 bits (290), Expect = 1.2e-22 Identity = 63/73 (86.30%), Postives = 65/73 (89.04%), Query Frame = 0
BLAST of CcUC07G138240.1 vs. NCBI nr
Match: KAG6600481.1 (VQ motif-containing protein 1, partial [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 90.5 bits (223), Expect = 7.1e-15 Identity = 52/71 (73.24%), Postives = 56/71 (78.87%), Query Frame = 0
BLAST of CcUC07G138240.1 vs. ExPASy Swiss-Prot
Match: Q8VYI5 (VQ motif-containing protein 10 OS=Arabidopsis thaliana OX=3702 GN=VQ10 PE=1 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 1.1e-07 Identity = 35/91 (38.46%), Postives = 50/91 (54.95%), Query Frame = 0
BLAST of CcUC07G138240.1 vs. ExPASy Swiss-Prot
Match: Q1G3U8 (VQ motif-containing protein 1 OS=Arabidopsis thaliana OX=3702 GN=VQ1 PE=1 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 3.3e-07 Identity = 36/83 (43.37%), Postives = 48/83 (57.83%), Query Frame = 0
BLAST of CcUC07G138240.1 vs. ExPASy TrEMBL
Match: A0A5A7VBD1 (VQ motif-containing protein 1-like OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold21G001280 PE=4 SV=1) HSP 1 Score: 134.8 bits (338), Expect = 1.6e-28 Identity = 73/81 (90.12%), Postives = 74/81 (91.36%), Query Frame = 0
BLAST of CcUC07G138240.1 vs. ExPASy TrEMBL
Match: A0A0A0KXJ0 (VQ domain-containing protein OS=Cucumis sativus OX=3659 GN=Csa_4G075740 PE=4 SV=1) HSP 1 Score: 128.6 bits (322), Expect = 1.1e-26 Identity = 70/81 (86.42%), Postives = 71/81 (87.65%), Query Frame = 0
BLAST of CcUC07G138240.1 vs. ExPASy TrEMBL
Match: A0A6J1FVF7 (VQ motif-containing protein 1 OS=Cucurbita moschata OX=3662 GN=LOC111447218 PE=4 SV=1) HSP 1 Score: 89.7 bits (221), Expect = 5.8e-15 Identity = 51/71 (71.83%), Postives = 55/71 (77.46%), Query Frame = 0
BLAST of CcUC07G138240.1 vs. ExPASy TrEMBL
Match: A0A6J1CNV7 (VQ motif-containing protein 10-like OS=Momordica charantia OX=3673 GN=LOC111012826 PE=4 SV=1) HSP 1 Score: 89.4 bits (220), Expect = 7.6e-15 Identity = 50/69 (72.46%), Postives = 55/69 (79.71%), Query Frame = 0
BLAST of CcUC07G138240.1 vs. ExPASy TrEMBL
Match: A0A3Q0EY25 (VQ motif-containing protein 1 OS=Vigna radiata var. radiata OX=3916 GN=LOC106760578 PE=4 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 3.3e-10 Identity = 43/73 (58.90%), Postives = 54/73 (73.97%), Query Frame = 0
BLAST of CcUC07G138240.1 vs. TAIR 10
Match: AT1G78410.1 (VQ motif-containing protein ) HSP 1 Score: 57.0 bits (136), Expect = 8.1e-09 Identity = 35/91 (38.46%), Postives = 50/91 (54.95%), Query Frame = 0
BLAST of CcUC07G138240.1 vs. TAIR 10
Match: AT1G17147.1 (VQ motif-containing protein ) HSP 1 Score: 55.5 bits (132), Expect = 2.3e-08 Identity = 36/83 (43.37%), Postives = 48/83 (57.83%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Watermelon (PI 537277) v1
Date Performed: 2022-01-31
Relationships
This mRNA is a part of the following gene feature(s):
The following exon feature(s) are a part of this mRNA:
The following CDS feature(s) are a part of this mRNA:
The following polypeptide feature(s) derives from this mRNA:
|