![](http://cucurbitgenomics.org/sites/default/files/styles/slideshow/public/carousel/101322_web.jpg?itok=EG-G51x6)
Tan0014336 (gene) Snake gourd v1
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCCGCTTTTGGAGAATCAGATCAAAACAGTACCAATGCAACACTCTGTGCCAACAACTGTGGCTTTTATGGAAATTCGAAGAATCTAAACCTCTGTTCCGCCGCTTTCCTCAAAGAAACCGGCGAAGATTCTCGACGACGACGAGAGAGCTCAAACGACGCCGTTCGCTCGAGAAACCTTGGCACAGAACTCGTCGGATCTCCTTCGGCGTCGGAGAGTTCCGAAACTTCTGAATCGATCGCCGATTTGAATAATCCGGCGCCTAAATCCAAAATTAGGTGCAAAATCTGCAAGAAGAAAGTTGGATTGTTGGGATTCAATTGCAAATTGAATGCAAGGCTGATAAACTGGATTTTAGGCTTTAGATTTCATGGAATTTGCTTTATTTTATTGATATTTTCATGCACATCTCAATAA ATGGCCGCTTTTGGAGAATCAGATCAAAACAGTACCAATGCAACACTCTGTGCCAACAACTGTGGCTTTTATGGAAATTCGAAGAATCTAAACCTCTGTTCCGCCGCTTTCCTCAAAGAAACCGGCGAAGATTCTCGACGACGACGAGAGAGCTCAAACGACGCCGTTCGCTCGAGAAACCTTGGCACAGAACTCGTCGGATCTCCTTCGGCGTCGGAGAGTTCCGAAACTTCTGAATCGATCGCCGATTTGAATAATCCGGCGCCTAAATCCAAAATTAGGTGCAAAATCTGCAAGAAGAAAGTTGGATTGTTGGGATTCAATTGCAAATTGAATGCAAGGCTGATAAACTGGATTTTAGGCTTTAGATTTCATGGAATTTGCTTTATTTTATTGATATTTTCATGCACATCTCAATAA ATGGCCGCTTTTGGAGAATCAGATCAAAACAGTACCAATGCAACACTCTGTGCCAACAACTGTGGCTTTTATGGAAATTCGAAGAATCTAAACCTCTGTTCCGCCGCTTTCCTCAAAGAAACCGGCGAAGATTCTCGACGACGACGAGAGAGCTCAAACGACGCCGTTCGCTCGAGAAACCTTGGCACAGAACTCGTCGGATCTCCTTCGGCGTCGGAGAGTTCCGAAACTTCTGAATCGATCGCCGATTTGAATAATCCGGCGCCTAAATCCAAAATTAGGTGCAAAATCTGCAAGAAGAAAGTTGGATTGTTGGGATTCAATTGCAAATTGAATGCAAGGCTGATAAACTGGATTTTAGGCTTTAGATTTCATGGAATTTGCTTTATTTTATTGATATTTTCATGCACATCTCAATAA MAAFGESDQNSTNATLCANNCGFYGNSKNLNLCSAAFLKETGEDSRRRRESSNDAVRSRNLGTELVGSPSASESSETSESIADLNNPAPKSKIRCKICKKKVGLLGFNCKLNARLINWILGFRFHGICFILLIFSCTSQ Homology
BLAST of Tan0014336 vs. ExPASy Swiss-Prot
Match: Q5JN07 (Zinc finger A20 and AN1 domain-containing stress-associated protein 3 OS=Oryza sativa subsp. japonica OX=39947 GN=SAP3 PE=2 SV=2) HSP 1 Score: 55.5 bits (132), Expect = 5.7e-07 Identity = 41/120 (34.17%), Postives = 55/120 (45.83%), Query Frame = 0
BLAST of Tan0014336 vs. ExPASy Swiss-Prot
Match: Q6NNI8 (Zinc finger A20 and AN1 domain-containing stress-associated protein 1 OS=Arabidopsis thaliana OX=3702 GN=SAP1 PE=1 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 8.3e-06 Identity = 37/122 (30.33%), Postives = 56/122 (45.90%), Query Frame = 0
BLAST of Tan0014336 vs. ExPASy Swiss-Prot
Match: Q94B40 (Zinc finger A20 and AN1 domain-containing stress-associated protein 6 OS=Arabidopsis thaliana OX=3702 GN=SAP6 PE=2 SV=2) HSP 1 Score: 49.7 bits (117), Expect = 3.1e-05 Identity = 39/125 (31.20%), Postives = 59/125 (47.20%), Query Frame = 0
BLAST of Tan0014336 vs. ExPASy Swiss-Prot
Match: Q9STJ9 (Zinc finger A20 and AN1 domain-containing stress-associated protein 10 OS=Arabidopsis thaliana OX=3702 GN=SAP10 PE=1 SV=1) HSP 1 Score: 48.5 bits (114), Expect = 7.0e-05 Identity = 35/105 (33.33%), Postives = 43/105 (40.95%), Query Frame = 0
BLAST of Tan0014336 vs. ExPASy Swiss-Prot
Match: Q9SJM6 (Zinc finger A20 and AN1 domain-containing stress-associated protein 4 OS=Arabidopsis thaliana OX=3702 GN=SAP4 PE=1 SV=1) HSP 1 Score: 48.5 bits (114), Expect = 7.0e-05 Identity = 37/104 (35.58%), Postives = 54/104 (51.92%), Query Frame = 0
BLAST of Tan0014336 vs. NCBI nr
Match: KAG6576775.1 (Pentatricopeptide repeat-containing protein, mitochondrial, partial [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 131.3 bits (329), Expect = 6.3e-27 Identity = 83/166 (50.00%), Postives = 97/166 (58.43%), Query Frame = 0
BLAST of Tan0014336 vs. NCBI nr
Match: KAG7014809.1 (Zinc finger A20 and AN1 domain-containing stress-associated protein 10, partial [Cucurbita argyrosperma subsp. argyrosperma]) HSP 1 Score: 123.2 bits (308), Expect = 1.7e-24 Identity = 70/113 (61.95%), Postives = 82/113 (72.57%), Query Frame = 0
BLAST of Tan0014336 vs. NCBI nr
Match: XP_038876927.1 (zinc finger A20 and AN1 domain-containing stress-associated protein 10-like [Benincasa hispida]) HSP 1 Score: 106.7 bits (265), Expect = 1.7e-19 Identity = 66/113 (58.41%), Postives = 76/113 (67.26%), Query Frame = 0
BLAST of Tan0014336 vs. NCBI nr
Match: XP_022141121.1 (zinc finger A20 and AN1 domain-containing stress-associated protein 5-like [Momordica charantia]) HSP 1 Score: 101.7 bits (252), Expect = 5.3e-18 Identity = 69/125 (55.20%), Postives = 77/125 (61.60%), Query Frame = 0
BLAST of Tan0014336 vs. NCBI nr
Match: TYK30331.1 (zinc finger A20 and AN1 domain-containing stress-associated protein 10-like [Cucumis melo var. makuwa]) HSP 1 Score: 90.9 bits (224), Expect = 9.4e-15 Identity = 56/104 (53.85%), Postives = 69/104 (66.35%), Query Frame = 0
BLAST of Tan0014336 vs. ExPASy TrEMBL
Match: A0A6J1CI30 (zinc finger A20 and AN1 domain-containing stress-associated protein 5-like OS=Momordica charantia OX=3673 GN=LOC111011593 PE=4 SV=1) HSP 1 Score: 101.7 bits (252), Expect = 2.6e-18 Identity = 69/125 (55.20%), Postives = 77/125 (61.60%), Query Frame = 0
BLAST of Tan0014336 vs. ExPASy TrEMBL
Match: A0A5D3E441 (Zinc finger A20 and AN1 domain-containing stress-associated protein 10-like OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold1044G00030 PE=4 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 4.6e-15 Identity = 56/104 (53.85%), Postives = 69/104 (66.35%), Query Frame = 0
BLAST of Tan0014336 vs. ExPASy TrEMBL
Match: A0A5A7SQW4 (Zinc finger A20 and AN1 domain-containing stress-associated protein 10-like OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold239G00030 PE=4 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 1.7e-14 Identity = 55/104 (52.88%), Postives = 69/104 (66.35%), Query Frame = 0
BLAST of Tan0014336 vs. ExPASy TrEMBL
Match: A0A1S3AZB4 (zinc finger A20 and AN1 domain-containing stress-associated protein 10-like OS=Cucumis melo OX=3656 GN=LOC103484207 PE=4 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 1.7e-14 Identity = 55/104 (52.88%), Postives = 69/104 (66.35%), Query Frame = 0
BLAST of Tan0014336 vs. ExPASy TrEMBL
Match: A0A0A0LB47 (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_3G177400 PE=4 SV=1) HSP 1 Score: 86.3 bits (212), Expect = 1.1e-13 Identity = 57/114 (50.00%), Postives = 72/114 (63.16%), Query Frame = 0
BLAST of Tan0014336 vs. TAIR 10
Match: AT1G12440.1 (A20/AN1-like zinc finger family protein ) HSP 1 Score: 51.6 bits (122), Expect = 5.9e-07 Identity = 37/122 (30.33%), Postives = 56/122 (45.90%), Query Frame = 0
BLAST of Tan0014336 vs. TAIR 10
Match: AT1G12440.2 (A20/AN1-like zinc finger family protein ) HSP 1 Score: 51.6 bits (122), Expect = 5.9e-07 Identity = 37/122 (30.33%), Postives = 56/122 (45.90%), Query Frame = 0
BLAST of Tan0014336 vs. TAIR 10
Match: AT3G52800.1 (A20/AN1-like zinc finger family protein ) HSP 1 Score: 49.7 bits (117), Expect = 2.2e-06 Identity = 39/125 (31.20%), Postives = 59/125 (47.20%), Query Frame = 0
BLAST of Tan0014336 vs. TAIR 10
Match: AT2G36320.1 (A20/AN1-like zinc finger family protein ) HSP 1 Score: 48.5 bits (114), Expect = 5.0e-06 Identity = 37/104 (35.58%), Postives = 54/104 (51.92%), Query Frame = 0
BLAST of Tan0014336 vs. TAIR 10
Match: AT4G25380.1 (stress-associated protein 10 ) HSP 1 Score: 48.5 bits (114), Expect = 5.0e-06 Identity = 35/105 (33.33%), Postives = 43/105 (40.95%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Snake gourd (anguina) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|