PI0010493 (gene) Melon (PI 482460) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGATAAATCCAAGCGACTCTTTCTTAAATCCAAACGATCTTTTCGTAGGCGTTTGCCCCCGATCCAATCGGGGGATCGAATTGATTATAGAAACATGAGTTTAATTAGTCGATTTATTAGTGAACAAGGAAAAATATTATCTAGACGGGTAAATAGATTGACCTTAAAACAGCAACGCTTAATTACTATTGCTATAAAACAAGCTCGTATTTTCTCTTTGTTACCTTTTCTTAATAATGAGAAAGAATTTGAAAGAAGCGAGTCGACCGCTAGAAGGTCTTAG ATGGATAAATCCAAGCGACTCTTTCTTAAATCCAAACGATCTTTTCGTAGGCGTTTGCCCCCGATCCAATCGGGGGATCGAATTGATTATAGAAACATGAGTTTAATTAGTCGATTTATTAGTGAACAAGGAAAAATATTATCTAGACGGGTAAATAGATTGACCTTAAAACAGCAACGCTTAATTACTATTGCTATAAAACAAGCTCGTATTTTCTCTTTGTTACCTTTTCTTAATAATGAGAAAGAATTTGAAAGAAGCGAGTCGACCGCTAGAAGGTCTTAG ATGGATAAATCCAAGCGACTCTTTCTTAAATCCAAACGATCTTTTCGTAGGCGTTTGCCCCCGATCCAATCGGGGGATCGAATTGATTATAGAAACATGAGTTTAATTAGTCGATTTATTAGTGAACAAGGAAAAATATTATCTAGACGGGTAAATAGATTGACCTTAAAACAGCAACGCTTAATTACTATTGCTATAAAACAAGCTCGTATTTTCTCTTTGTTACCTTTTCTTAATAATGAGAAAGAATTTGAAAGAAGCGAGTCGACCGCTAGAAGGTCTTAG MDKSKRLFLKSKRSFRRRLPPIQSGDRIDYRNMSLISRFISEQGKILSRRVNRLTLKQQRLITIAIKQARIFSLLPFLNNEKEFERSESTARRS Homology
BLAST of PI0010493 vs. ExPASy Swiss-Prot
Match: A0ZZ57 (30S ribosomal protein S18, chloroplastic OS=Gossypium barbadense OX=3634 GN=rps18 PE=3 SV=1) HSP 1 Score: 167.5 bits (423), Expect = 7.0e-41 Identity = 89/92 (96.74%), Postives = 90/92 (97.83%), Query Frame = 0
BLAST of PI0010493 vs. ExPASy Swiss-Prot
Match: Q49KX7 (30S ribosomal protein S18, chloroplastic OS=Eucalyptus globulus subsp. globulus OX=71271 GN=rps18 PE=3 SV=1) HSP 1 Score: 166.0 bits (419), Expect = 2.0e-40 Identity = 88/91 (96.70%), Postives = 90/91 (98.90%), Query Frame = 0
BLAST of PI0010493 vs. ExPASy Swiss-Prot
Match: Q2L928 (30S ribosomal protein S18, chloroplastic OS=Gossypium hirsutum OX=3635 GN=rps18 PE=3 SV=1) HSP 1 Score: 165.2 bits (417), Expect = 3.5e-40 Identity = 88/92 (95.65%), Postives = 89/92 (96.74%), Query Frame = 0
BLAST of PI0010493 vs. ExPASy Swiss-Prot
Match: Q09WZ5 (30S ribosomal protein S18, chloroplastic OS=Morus indica OX=248361 GN=rps18 PE=3 SV=1) HSP 1 Score: 165.2 bits (417), Expect = 3.5e-40 Identity = 88/92 (95.65%), Postives = 89/92 (96.74%), Query Frame = 0
BLAST of PI0010493 vs. ExPASy Swiss-Prot
Match: Q68RY4 (30S ribosomal protein S18, chloroplastic OS=Panax ginseng OX=4054 GN=rps18 PE=3 SV=1) HSP 1 Score: 164.1 bits (414), Expect = 7.7e-40 Identity = 87/92 (94.57%), Postives = 90/92 (97.83%), Query Frame = 0
BLAST of PI0010493 vs. ExPASy TrEMBL
Match: E5KUB8 (30S ribosomal protein S18, chloroplastic OS=Corynocarpus laevigatus OX=4312 GN=rps18 PE=3 SV=1) HSP 1 Score: 169.1 bits (427), Expect = 8.9e-39 Identity = 90/92 (97.83%), Postives = 91/92 (98.91%), Query Frame = 0
BLAST of PI0010493 vs. ExPASy TrEMBL
Match: A0A481YMA7 (30S ribosomal protein S18, chloroplastic OS=Bixa orellana OX=66672 GN=rps18 PE=3 SV=1) HSP 1 Score: 168.3 bits (425), Expect = 1.5e-38 Identity = 89/92 (96.74%), Postives = 91/92 (98.91%), Query Frame = 0
BLAST of PI0010493 vs. ExPASy TrEMBL
Match: A0A7T6ZU27 (Ribosomal protein S18 OS=Rubus henryi OX=1521122 GN=rps18 PE=4 SV=1) HSP 1 Score: 168.3 bits (425), Expect = 1.5e-38 Identity = 89/92 (96.74%), Postives = 91/92 (98.91%), Query Frame = 0
BLAST of PI0010493 vs. ExPASy TrEMBL
Match: A0A7T7CNH5 (Ribosomal protein S18 OS=Rubus ichangensis OX=421244 GN=rps18 PE=4 SV=1) HSP 1 Score: 168.3 bits (425), Expect = 1.5e-38 Identity = 89/92 (96.74%), Postives = 91/92 (98.91%), Query Frame = 0
BLAST of PI0010493 vs. ExPASy TrEMBL
Match: A0A7T6ZU85 (Ribosomal protein S18 OS=Rubus setchuenensis OX=421253 GN=rps18 PE=4 SV=1) HSP 1 Score: 168.3 bits (425), Expect = 1.5e-38 Identity = 89/92 (96.74%), Postives = 91/92 (98.91%), Query Frame = 0
BLAST of PI0010493 vs. NCBI nr
Match: YP_004072484.1 (ribosomal protein S18 [Corynocarpus laevigatus] >ADO60332.1 ribosomal protein S18 [Corynocarpus laevigatus]) HSP 1 Score: 169.1 bits (427), Expect = 1.8e-38 Identity = 90/92 (97.83%), Postives = 91/92 (98.91%), Query Frame = 0
BLAST of PI0010493 vs. NCBI nr
Match: QTA71770.1 (ribosomal protein S18 [Coriaria nepalensis]) HSP 1 Score: 169.1 bits (427), Expect = 1.8e-38 Identity = 90/92 (97.83%), Postives = 91/92 (98.91%), Query Frame = 0
BLAST of PI0010493 vs. NCBI nr
Match: YP_009582194.1 (ribosomal protein S18 [Bixa orellana] >QBK83729.1 ribosomal protein S18 [Bixa orellana] >QGS65371.1 ribosomal protein S18 [Bixa orellana]) HSP 1 Score: 168.3 bits (425), Expect = 3.1e-38 Identity = 89/92 (96.74%), Postives = 91/92 (98.91%), Query Frame = 0
BLAST of PI0010493 vs. NCBI nr
Match: YP_009575620.1 (ribosomal protein S18 [Pyrus ussuriensis] >AQR56716.1 ribosomal protein S18 [Adenostoma fasciculatum] >ARC96595.1 ribosomal protein S18 [Sorbaria sorbifolia] >ARD03481.1 ribosomal protein S18 [Chamaebatiaria millefolium] >AUB30005.1 ribosomal protein S18 [Pyrus hopeiensis] >QRH19219.1 ribosomal protein S18 [Sorbaria arborea]) HSP 1 Score: 168.3 bits (425), Expect = 3.1e-38 Identity = 89/92 (96.74%), Postives = 91/92 (98.91%), Query Frame = 0
BLAST of PI0010493 vs. NCBI nr
Match: YP_010040089.1 (ribosomal protein S18 [Neillia incisa] >ARC97371.1 ribosomal protein S18 [Neillia hanceana] >ARC99768.1 ribosomal protein S18 [Neillia serratisepala] >ARD02629.1 ribosomal protein S18 [Neillia gracilis] >QOY46685.1 ribosomal protein S18 [Neillia incisa]) HSP 1 Score: 168.3 bits (425), Expect = 3.1e-38 Identity = 89/92 (96.74%), Postives = 91/92 (98.91%), Query Frame = 0
BLAST of PI0010493 vs. TAIR 10
Match: ATCG00650.1 (ribosomal protein S18 ) HSP 1 Score: 161.0 bits (406), Expect = 4.7e-40 Identity = 85/92 (92.39%), Postives = 89/92 (96.74%), Query Frame = 0
BLAST of PI0010493 vs. TAIR 10
Match: AT1G07210.1 (Ribosomal protein S18 ) HSP 1 Score: 43.1 bits (100), Expect = 1.4e-04 Identity = 21/49 (42.86%), Postives = 31/49 (63.27%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Melon (PI 482460) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|