MS016846 (gene) Bitter gourd (TR) v1
|
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.GTTTCCACGAGACTGTTAGAGTTTGAAAGGAGTGTTTCAGTTAAGTTTCCAGCTTGCTCTGTTGCTGCAAAGAAGCATATTGATTCATCTACAAGGATTTTGGATGTTGAAGGCGTGGTTTCCACGAGACTGTTAGAGTTTGAAAGGAGTGTTTCAGTTAAGTTTCCAGCTTGCTCTGTTGCTGCAAAGAAGCATATTGATTCATCTACAAGGATTTTGGATGTTGAAGGCGTG GTTTCCACGAGACTGTTAGAGTTTGAAAGGAGTGTTTCAGTTAAGTTTCCAGCTTGCTCTGTTGCTGCAAAGAAGCATATTGATTCATCTACAAGGATTTTGGATGTTGAAGGCGTG VSTRLLEFERSVSVKFPACSVAAKKHIDSSTRILDVEGV Homology
BLAST of MS016846 vs. NCBI nr
Match: XP_020251533.1 (phosphatidylinositol/phosphatidylcholine transfer protein SFH6-like isoform X1 [Asparagus officinalis] >XP_020251534.1 phosphatidylinositol/phosphatidylcholine transfer protein SFH6-like isoform X1 [Asparagus officinalis]) HSP 1 Score: 61.2 bits (147), Expect = 2.2e-06 Identity = 28/33 (84.85%), Postives = 31/33 (93.94%), Query Frame = 0
BLAST of MS016846 vs. NCBI nr
Match: CAD1822724.1 (unnamed protein product [Ananas comosus var. bracteatus]) HSP 1 Score: 61.2 bits (147), Expect = 2.2e-06 Identity = 28/33 (84.85%), Postives = 31/33 (93.94%), Query Frame = 0
BLAST of MS016846 vs. NCBI nr
Match: CAD1822716.1 (unnamed protein product [Ananas comosus var. bracteatus]) HSP 1 Score: 61.2 bits (147), Expect = 2.2e-06 Identity = 28/33 (84.85%), Postives = 31/33 (93.94%), Query Frame = 0
BLAST of MS016846 vs. NCBI nr
Match: XP_020251535.1 (phosphatidylinositol/phosphatidylcholine transfer protein SFH6-like isoform X2 [Asparagus officinalis]) HSP 1 Score: 61.2 bits (147), Expect = 2.2e-06 Identity = 28/33 (84.85%), Postives = 31/33 (93.94%), Query Frame = 0
BLAST of MS016846 vs. NCBI nr
Match: ONK81270.1 (uncharacterized protein A4U43_C01F27220 [Asparagus officinalis]) HSP 1 Score: 61.2 bits (147), Expect = 2.2e-06 Identity = 28/33 (84.85%), Postives = 31/33 (93.94%), Query Frame = 0
BLAST of MS016846 vs. ExPASy Swiss-Prot
Match: Q9SI13 (Phosphatidylinositol/phosphatidylcholine transfer protein SFH10 OS=Arabidopsis thaliana OX=3702 GN=SFH10 PE=3 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 6.5e-09 Identity = 27/39 (69.23%), Postives = 34/39 (87.18%), Query Frame = 0
BLAST of MS016846 vs. ExPASy Swiss-Prot
Match: Q94A34 (Phosphatidylinositol/phosphatidylcholine transfer protein SFH12 OS=Arabidopsis thaliana OX=3702 GN=SFH12 PE=2 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 6.5e-09 Identity = 27/39 (69.23%), Postives = 34/39 (87.18%), Query Frame = 0
BLAST of MS016846 vs. ExPASy Swiss-Prot
Match: F4JVA9 (Phosphatidylinositol/phosphatidylcholine transfer protein SFH2 OS=Arabidopsis thaliana OX=3702 GN=SFH2 PE=3 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 1.2e-07 Identity = 25/39 (64.10%), Postives = 32/39 (82.05%), Query Frame = 0
BLAST of MS016846 vs. ExPASy Swiss-Prot
Match: F4HP88 (Phosphatidylinositol/phosphatidylcholine transfer protein SFH4 OS=Arabidopsis thaliana OX=3702 GN=SFH4 PE=2 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 1.6e-07 Identity = 23/33 (69.70%), Postives = 31/33 (93.94%), Query Frame = 0
BLAST of MS016846 vs. ExPASy Swiss-Prot
Match: F4JVA6 (Phosphatidylinositol/phosphatidylcholine transfer protein SFH6 OS=Arabidopsis thaliana OX=3702 GN=SFH6 PE=2 SV=1) HSP 1 Score: 55.1 bits (131), Expect = 2.1e-07 Identity = 25/33 (75.76%), Postives = 30/33 (90.91%), Query Frame = 0
BLAST of MS016846 vs. ExPASy TrEMBL
Match: A0A6P5FUV3 (phosphatidylinositol/phosphatidylcholine transfer protein SFH8-like OS=Ananas comosus OX=4615 GN=LOC109718313 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 1.1e-06 Identity = 28/33 (84.85%), Postives = 31/33 (93.94%), Query Frame = 0
BLAST of MS016846 vs. ExPASy TrEMBL
Match: A0A5P1FWG0 (CRAL-TRIO domain-containing protein OS=Asparagus officinalis OX=4686 GN=A4U43_C01F27220 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 1.1e-06 Identity = 28/33 (84.85%), Postives = 31/33 (93.94%), Query Frame = 0
BLAST of MS016846 vs. ExPASy TrEMBL
Match: A0A6V7NWG9 (CRAL-TRIO domain-containing protein OS=Ananas comosus var. bracteatus OX=296719 GN=CB5_LOCUS5927 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 1.1e-06 Identity = 28/33 (84.85%), Postives = 31/33 (93.94%), Query Frame = 0
BLAST of MS016846 vs. ExPASy TrEMBL
Match: A0A6V7NWI7 (CRAL-TRIO domain-containing protein OS=Ananas comosus var. bracteatus OX=296719 GN=CB5_LOCUS5935 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 1.1e-06 Identity = 28/33 (84.85%), Postives = 31/33 (93.94%), Query Frame = 0
BLAST of MS016846 vs. ExPASy TrEMBL
Match: A0A5S9XZ67 (Uncharacterized protein OS=Arabidopsis thaliana OX=3702 GN=AN1_LOCUS20494 PE=4 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 2.4e-06 Identity = 27/39 (69.23%), Postives = 34/39 (87.18%), Query Frame = 0
BLAST of MS016846 vs. TAIR 10
Match: AT2G18180.1 (Sec14p-like phosphatidylinositol transfer family protein ) HSP 1 Score: 60.1 bits (144), Expect = 4.6e-10 Identity = 27/39 (69.23%), Postives = 34/39 (87.18%), Query Frame = 0
BLAST of MS016846 vs. TAIR 10
Match: AT4G36490.1 (SEC14-like 12 ) HSP 1 Score: 60.1 bits (144), Expect = 4.6e-10 Identity = 27/39 (69.23%), Postives = 34/39 (87.18%), Query Frame = 0
BLAST of MS016846 vs. TAIR 10
Match: AT4G39180.1 (Sec14p-like phosphatidylinositol transfer family protein ) HSP 1 Score: 55.8 bits (133), Expect = 8.8e-09 Identity = 25/39 (64.10%), Postives = 32/39 (82.05%), Query Frame = 0
BLAST of MS016846 vs. TAIR 10
Match: AT4G39180.2 (Sec14p-like phosphatidylinositol transfer family protein ) HSP 1 Score: 55.8 bits (133), Expect = 8.8e-09 Identity = 25/39 (64.10%), Postives = 32/39 (82.05%), Query Frame = 0
BLAST of MS016846 vs. TAIR 10
Match: AT1G19650.1 (Sec14p-like phosphatidylinositol transfer family protein ) HSP 1 Score: 55.5 bits (132), Expect = 1.1e-08 Identity = 23/33 (69.70%), Postives = 31/33 (93.94%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (TR) v1
Date Performed: 2021-10-25 Position : 0 Zoom : x 1
Relationships
The following mRNA feature(s) are a part of this gene:
|