MS014549 (gene) Bitter gourd (TR) v1
|
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.CCCCTTTTTCATGTGGATTTACCCATTACAGAGATGCACAGAGGAACAGAACGAACTTCTTATATCCCTTTTCCCCTTTTTCATGTGGATTTACCCATTACAGAGATGCACAGAGGAACAGAACGAACTTCTTATATCCCTTTT CCCCTTTTTCATGTGGATTTACCCATTACAGAGATGCACAGAGGAACAGAACGAACTTCTTATATCCCTTTT PLFHVDLPITEMHRGTERTSYIPF Homology
BLAST of MS014549 vs. NCBI nr
Match: QHU79916.1 (ribosomal protein S4 [Pediomelum digitatum] >QHU79917.1 ribosomal protein S4 [Pediomelum tenuiflorum] >QHU79918.1 ribosomal protein S4 [Pediomelum argophyllum] >QHU79922.1 ribosomal protein S4 [Pediomelum esculentum] >QHU79919.1 ribosomal protein S4 [Pediomelum digitatum]) HSP 1 Score: 55.5 bits (132), Expect = 7.6e-05 Identity = 23/24 (95.83%), Postives = 23/24 (95.83%), Query Frame = 0
BLAST of MS014549 vs. NCBI nr
Match: YP_009709883.1 (ribosomal protein S4 [Phaseolus vulgaris] >QFI36096.1 ribosomal protein S4 [Phaseolus vulgaris]) HSP 1 Score: 55.5 bits (132), Expect = 7.6e-05 Identity = 23/24 (95.83%), Postives = 23/24 (95.83%), Query Frame = 0
BLAST of MS014549 vs. NCBI nr
Match: KAG4906037.1 (hypothetical protein JHK86_057284 [Glycine max] >KAG4906048.1 hypothetical protein JHK86_057295 [Glycine max] >KAG4950667.1 hypothetical protein JHK86_043906 [Glycine max]) HSP 1 Score: 55.5 bits (132), Expect = 7.6e-05 Identity = 23/24 (95.83%), Postives = 23/24 (95.83%), Query Frame = 0
BLAST of MS014549 vs. NCBI nr
Match: YP_007516900.1 (ribosomal protein S4 [Glycine max] >YP_009532841.1 ribosomal protein S4 [Glycine soja] >AFR34319.1 ribosomal protein S4 [Glycine max] >AYD72989.1 ribosomal protein S4 [Glycine soja] >KAG4906094.1 hypothetical protein JHK85_058285 [Glycine max] >KAG4914302.1 hypothetical protein JHK87_051859 [Glycine soja] >KAG5070557.1 hypothetical protein JHK84_057414 [Glycine max]) HSP 1 Score: 55.5 bits (132), Expect = 7.6e-05 Identity = 23/24 (95.83%), Postives = 23/24 (95.83%), Query Frame = 0
BLAST of MS014549 vs. NCBI nr
Match: QHU79921.1 (ribosomal protein S4 [Ladeania lanceolata]) HSP 1 Score: 55.5 bits (132), Expect = 7.6e-05 Identity = 23/24 (95.83%), Postives = 23/24 (95.83%), Query Frame = 0
BLAST of MS014549 vs. ExPASy Swiss-Prot
Match: Q31708 (Ribosomal protein S4, mitochondrial OS=Arabidopsis thaliana OX=3702 GN=RPS4 PE=1 SV=2) HSP 1 Score: 48.9 bits (115), Expect = 9.3e-06 Identity = 20/24 (83.33%), Postives = 22/24 (91.67%), Query Frame = 0
BLAST of MS014549 vs. ExPASy TrEMBL
Match: A0A6C0M9E6 (Ribosomal protein S4 OS=Pediomelum tenuiflorum OX=247917 PE=3 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 3.7e-05 Identity = 23/24 (95.83%), Postives = 23/24 (95.83%), Query Frame = 0
BLAST of MS014549 vs. ExPASy TrEMBL
Match: A0A6C0MEQ7 (Ribosomal protein S4 OS=Pediomelum digitatum OX=458362 PE=3 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 3.7e-05 Identity = 23/24 (95.83%), Postives = 23/24 (95.83%), Query Frame = 0
BLAST of MS014549 vs. ExPASy TrEMBL
Match: A0A6C0MC80 (Ribosomal protein S4 OS=Pediomelum argophyllum OX=458352 PE=3 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 3.7e-05 Identity = 23/24 (95.83%), Postives = 23/24 (95.83%), Query Frame = 0
BLAST of MS014549 vs. ExPASy TrEMBL
Match: A0A386JNF1 (Ribosomal protein S4 OS=Glycine soja OX=3848 GN=rps4 PE=3 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 3.7e-05 Identity = 23/24 (95.83%), Postives = 23/24 (95.83%), Query Frame = 0
BLAST of MS014549 vs. ExPASy TrEMBL
Match: N0DKE5 (Ribosomal protein S4 OS=Phaseolus angularis OX=3914 GN=rps4 PE=3 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 3.7e-05 Identity = 23/24 (95.83%), Postives = 23/24 (95.83%), Query Frame = 0
BLAST of MS014549 vs. TAIR 10
Match: AT2G07734.1 (Alpha-L RNA-binding motif/Ribosomal protein S4 family protein ) HSP 1 Score: 52.8 bits (125), Expect = 4.6e-08 Identity = 22/24 (91.67%), Postives = 23/24 (95.83%), Query Frame = 0
BLAST of MS014549 vs. TAIR 10
Match: ATMG00290.1 (mitochondrial ribosomal protein S4 ) HSP 1 Score: 52.8 bits (125), Expect = 4.6e-08 Identity = 22/24 (91.67%), Postives = 23/24 (95.83%), Query Frame = 0
The following BLAST results are available for this feature:
Relationships
The following mRNA feature(s) are a part of this gene:
|