CU108561 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)

Overview


Name	CU108561
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	No hit
Location	Chr3 : 15081711 .. 15254870 (+)
Sequence length	288

Genome Viewer

Sequences

The following sequences are available for this feature:

transcribed_cluster sequence

CTAAAGACTAACAACTGAATTATTCTCACTGTAGATATATTTTTGTATCCACGGATATAGACCAATAACAGTAAGTTAGTCATTCATGAGTGTTCGTAACACTAGTTGGGTCAGTTTACCGTTTTATCTCTGGGTTACCTCTAATCCTTAAATATCAGTGTTCCTCCAATAAAGAGGGTAGGGCCCTTTGTTCAAGATCTAAAGACACCATTTAAGAGAACACTCATCTACTTACCCTAAAGTATGGAAGGAGTGAATTTCATCTTGTGTAATTATATTCCCAGCCCC

Library


Library category	ESTs
gynoecious flower library	1
hermaphrodite flower library	1

Homology

The following BLAST results are available for this feature:

BLAST of CU108561 vs. NCBI nr


Match Name	E-value	Identity	Description

Relationships

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa3G236020	Csa3G236020	gene
Csa3G232950	Csa3G232950	gene
Csa3G233480	Csa3G233480	gene
Csa3G233470	Csa3G233470	gene
Csa3G236580	Csa3G236580	gene
Csa3G236570	Csa3G236570	gene
Csa3G234520	Csa3G234520	gene
Csa3G234010	Csa3G234010	gene
Csa3G232960	Csa3G232960	gene
Csa3G234000	Csa3G234000	gene
Csa3G236550	Csa3G236550	gene
Csa3G236040	Csa3G236040	gene
Csa3G236590	Csa3G236590	gene
Csa3G236030	Csa3G236030	gene
Csa3G236050	Csa3G236050	gene
Csa3G233980	Csa3G233980	gene
Csa3G234020	Csa3G234020	gene
Csa3G236560	Csa3G236560	gene
Csa3G233990	Csa3G233990	gene
Csa3G232970	Csa3G232970	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
G0099846	G0099846	EST
H0023724	H0023724	EST