CU085616 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GACAACAAGCTTTGATATTAGTTTTCTCTTGCGCACTTTTTTCTTCTTAATATTTAAAACCTATATAACCGTATTTGGACCAAATTTGGTCAAATTTGGTCCAAAGAGGTTATAAGGTTTTAAACAAACTTGAAAGAAACCTTAGATATCAAGTGTACTTGTGTGTTGCTCGGCTTCATTTTATCTGCAAGGAAAACTCTATCATATTAAGAAGGCATGGATAAGGTTAAAAGGTTGGTTGCCGAGAGGAGTGTGGTCATCTTCAGCAAAAGCTCATGCTGCCTATCATATGCAGTTAACATTCTATTTGGGGAACTTGGAGTCAATCCTCTCGTATATGAGATTGACCAAGACCCTGATACAGGGAAATAGAGAAAGCTCTCATGAGGCTAGGATGCAATGCACCAGTACCAGCCGTATTCATCGGCGGAAAGCTGGTCGGATCCACAAATGAAATCATGTCACACCACCTAAGCGGTGATCTGACCAAAATGCTGGTGCAAAGCCATGCTTTGAATAAATACTAAATCTAATCAAATTATTGACTATTCTGTTGGAGAAGGAAAACAATAATAATTGGCTCAAGTTTATAATGAATAGTTATGTTATGTCTTATGTCTCAAGAATTATGCAGCAATTGTTTAGCTGTGTAGTATGTAATACCTTTGTTATTGATAATGAAGTCAGCTCCTATTTTATTGTGAACTA
BLAST of CU085616 vs. Swiss-Prot
Match: GRXS9_ARATH (Monothiol glutaredoxin-S9 OS=Arabidopsis thaliana GN=GRXS9 PE=3 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 8.8e-13 Identity = 34/48 (70.83%), Postives = 39/48 (81.25%), Query Frame = 3
HSP 2 Score: 72.4 bits (176), Expect = 7.4e-12 Identity = 32/48 (66.67%), Postives = 40/48 (83.33%), Query Frame = 1
BLAST of CU085616 vs. Swiss-Prot
Match: GRS11_ARATH (Monothiol glutaredoxin-S11 OS=Arabidopsis thaliana GN=GRXS11 PE=3 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 2.0e-12 Identity = 36/48 (75.00%), Postives = 38/48 (79.17%), Query Frame = 3
HSP 2 Score: 73.6 bits (179), Expect = 3.3e-12 Identity = 32/48 (66.67%), Postives = 40/48 (83.33%), Query Frame = 1
BLAST of CU085616 vs. Swiss-Prot
Match: GRC13_ARATH (Glutaredoxin-C13 OS=Arabidopsis thaliana GN=GRXC13 PE=3 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 7.4e-12 Identity = 34/48 (70.83%), Postives = 38/48 (79.17%), Query Frame = 3
HSP 2 Score: 68.2 bits (165), Expect = 1.4e-10 Identity = 31/48 (64.58%), Postives = 36/48 (75.00%), Query Frame = 1
BLAST of CU085616 vs. Swiss-Prot
Match: GRC14_ARATH (Glutaredoxin-C14 OS=Arabidopsis thaliana GN=GRXC14 PE=3 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 1.4e-10 Identity = 31/48 (64.58%), Postives = 36/48 (75.00%), Query Frame = 1
HSP 2 Score: 66.6 bits (161), Expect = 4.1e-10 Identity = 32/48 (66.67%), Postives = 36/48 (75.00%), Query Frame = 3
BLAST of CU085616 vs. Swiss-Prot
Match: GRXS2_ARATH (Monothiol glutaredoxin-S2 OS=Arabidopsis thaliana GN=GRXS2 PE=3 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 4.1e-10 Identity = 32/51 (62.75%), Postives = 38/51 (74.51%), Query Frame = 3
HSP 2 Score: 56.6 bits (135), Expect = 4.2e-07 Identity = 23/45 (51.11%), Postives = 31/45 (68.89%), Query Frame = 1
BLAST of CU085616 vs. TrEMBL
Match: A0A0A0K5X2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G394080 PE=4 SV=1) HSP 1 Score: 115.2 bits (287), Expect = 1.1e-22 Identity = 56/57 (98.25%), Postives = 56/57 (98.25%), Query Frame = 3
BLAST of CU085616 vs. TrEMBL
Match: A0A0A0K5X2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G394080 PE=4 SV=1) HSP 1 Score: 98.6 bits (244), Expect = 1.1e-17 Identity = 48/48 (100.00%), Postives = 48/48 (100.00%), Query Frame = 1
HSP 2 Score: 81.6 bits (200), Expect = 1.4e-12 Identity = 38/48 (79.17%), Postives = 43/48 (89.58%), Query Frame = 1
BLAST of CU085616 vs. TrEMBL
Match: V4TVB9_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10023018mg PE=4 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 2.8e-10 Identity = 34/45 (75.56%), Postives = 41/45 (91.11%), Query Frame = 3
HSP 2 Score: 81.6 bits (200), Expect = 1.4e-12 Identity = 38/48 (79.17%), Postives = 43/48 (89.58%), Query Frame = 1
BLAST of CU085616 vs. TrEMBL
Match: A0A067HHD6_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g034205mg PE=4 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 2.8e-10 Identity = 34/45 (75.56%), Postives = 41/45 (91.11%), Query Frame = 3
HSP 2 Score: 80.9 bits (198), Expect = 2.3e-12 Identity = 40/52 (76.92%), Postives = 45/52 (86.54%), Query Frame = 3
BLAST of CU085616 vs. TrEMBL
Match: A0A151TX38_CAJCA (Glutaredoxin-C13 OS=Cajanus cajan GN=KK1_010882 PE=4 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 7.5e-11 Identity = 35/48 (72.92%), Postives = 41/48 (85.42%), Query Frame = 1
HSP 2 Score: 80.5 bits (197), Expect = 3.0e-12 Identity = 43/79 (54.43%), Postives = 56/79 (70.89%), Query Frame = 3
BLAST of CU085616 vs. NCBI nr
Match: gi|449436549|ref|XP_004136055.1| (PREDICTED: monothiol glutaredoxin-S11 [Cucumis sativus]) HSP 1 Score: 119.4 bits (298), Expect = 8.5e-24 Identity = 56/57 (98.25%), Postives = 56/57 (98.25%), Query Frame = 3
BLAST of CU085616 vs. NCBI nr
Match: gi|223540061|gb|EEF41638.1| (glutaredoxin, grx, putative [Ricinus communis]) HSP 1 Score: 88.6 bits (218), Expect = 1.6e-14 Identity = 43/79 (54.43%), Postives = 56/79 (70.89%), Query Frame = 3
BLAST of CU085616 vs. NCBI nr
Match: gi|1012183911|ref|XP_015968943.1| (PREDICTED: monothiol glutaredoxin-S11-like [Arachis duranensis]) HSP 1 Score: 85.1 bits (209), Expect = 1.8e-13 Identity = 39/45 (86.67%), Postives = 43/45 (95.56%), Query Frame = 3
BLAST of CU085616 vs. NCBI nr
Match: gi|1012360431|gb|KYP71615.1| (Glutaredoxin-C13 [Cajanus cajan]) HSP 1 Score: 84.7 bits (208), Expect = 2.3e-13 Identity = 40/52 (76.92%), Postives = 45/52 (86.54%), Query Frame = 3
BLAST of CU085616 vs. NCBI nr
Match: gi|351723175|ref|NP_001235478.1| (uncharacterized protein LOC100499748 [Glycine max]) HSP 1 Score: 83.2 bits (204), Expect = 6.7e-13 Identity = 40/52 (76.92%), Postives = 44/52 (84.62%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|