CmoCh06G010710 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonfive_prime_UTRCDSthree_prime_UTR Hold the cursor over a type above to highlight its positions in the sequence below.TTCATCATTTCTTCCACAGATTTGTTTCTTTGGAGAGGGACAGCAACAATGGCGTCGTCGTCCTCCGATTCTACTCCTACGGCCTTCTCTGGCTTCTTCACATGCTTCGCTCTCATCTTCTTCATTCTATCGCCACTCGTTCACGCGCACTCTTCGGCTTCTGCTCCCGCTCCCGCTCCCGCTAGCGACGGTAATCTACGCATCTGATTTCTAAGCTCCATCAGTTTTTGTGTCTGCATTGTTCTTTTTGTTGATTGATGATGATGATGATGAATGTAGGTTTTTCAAATTTTTGATTTGGAAGTGATTTGTTGACAATTTTGTGTAAAATCAGGGACCTCCATAGACCAGGGGATTGCGTACGTGTTGATGCTGATGGCGTTGGTTCTCACATATCTCATCCATCCTCTCGATGCATCTTCCTACCAATTTTTTCTGAAATGAGCTCTAGGATTGTAGCAATGTTGGCGCTGTTTTTCGGATTTTTGAAGATGCGGTTAGTGGATAAATCATGAAGTAAGGCCAACTTTCTTGCTCTCGTTGTGATAAATGTAGGGTTGAAGAGGAATTTTCATGTTGAGTTTGCCAGATTTTGATCCATTCTTTTATTTATTGATTGTTTAATCCATTACTTTCAATTTTGT TTCATCATTTCTTCCACAGATTTGTTTCTTTGGAGAGGGACAGCAACAATGGCGTCGTCGTCCTCCGATTCTACTCCTACGGCCTTCTCTGGCTTCTTCACATGCTTCGCTCTCATCTTCTTCATTCTATCGCCACTCGTTCACGCGCACTCTTCGGCTTCTGCTCCCGCTCCCGCTCCCGCTAGCGACGGGACCTCCATAGACCAGGGGATTGCGTACGTGTTGATGCTGATGGCGTTGGTTCTCACATATCTCATCCATCCTCTCGATGCATCTTCCTACCAATTTTTTCTGAAATGAGCTCTAGGATTGTAGCAATGTTGGCGCTGTTTTTCGGATTTTTGAAGATGCGGTTAGTGGATAAATCATGAAGTAAGGCCAACTTTCTTGCTCTCGTTGTGATAAATGTAGGGTTGAAGAGGAATTTTCATGTTGAGTTTGCCAGATTTTGATCCATTCTTTTATTTATTGATTGTTTAATCCATTACTTTCAATTTTGT ATGGCGTCGTCGTCCTCCGATTCTACTCCTACGGCCTTCTCTGGCTTCTTCACATGCTTCGCTCTCATCTTCTTCATTCTATCGCCACTCGTTCACGCGCACTCTTCGGCTTCTGCTCCCGCTCCCGCTCCCGCTAGCGACGGGACCTCCATAGACCAGGGGATTGCGTACGTGTTGATGCTGATGGCGTTGGTTCTCACATATCTCATCCATCCTCTCGATGCATCTTCCTACCAATTTTTTCTGAAATGA
BLAST of CmoCh06G010710 vs. Swiss-Prot
Match: AGP20_ARATH (Arabinogalactan peptide 20 OS=Arabidopsis thaliana GN=AGP20 PE=3 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 1.6e-14 Identity = 44/64 (68.75%), Postives = 51/64 (79.69%), Query Frame = 1
BLAST of CmoCh06G010710 vs. Swiss-Prot
Match: AGP16_ARATH (Arabinogalactan peptide 16 OS=Arabidopsis thaliana GN=AGP16 PE=1 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 6.2e-14 Identity = 44/66 (66.67%), Postives = 51/66 (77.27%), Query Frame = 1
BLAST of CmoCh06G010710 vs. Swiss-Prot
Match: AGP22_ARATH (Arabinogalactan peptide 22 OS=Arabidopsis thaliana GN=AGP22 PE=3 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 1.9e-10 Identity = 35/52 (67.31%), Postives = 41/52 (78.85%), Query Frame = 1
BLAST of CmoCh06G010710 vs. TrEMBL
Match: A0A0A0L7A0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G120410 PE=4 SV=1) HSP 1 Score: 106.3 bits (264), Expect = 1.8e-20 Identity = 60/78 (76.92%), Postives = 64/78 (82.05%), Query Frame = 1
BLAST of CmoCh06G010710 vs. TrEMBL
Match: A0A061DUP4_THECC (Arabinogalactan protein 20 OS=Theobroma cacao GN=TCM_005200 PE=4 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 3.2e-17 Identity = 52/70 (74.29%), Postives = 57/70 (81.43%), Query Frame = 1
BLAST of CmoCh06G010710 vs. TrEMBL
Match: A0A0D2TCU0_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_007G105900 PE=4 SV=1) HSP 1 Score: 92.0 bits (227), Expect = 3.6e-16 Identity = 50/64 (78.12%), Postives = 55/64 (85.94%), Query Frame = 1
BLAST of CmoCh06G010710 vs. TrEMBL
Match: A0A0B0PYH7_GOSAR (Uncharacterized protein OS=Gossypium arboreum GN=F383_05303 PE=4 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 6.1e-16 Identity = 50/69 (72.46%), Postives = 55/69 (79.71%), Query Frame = 1
BLAST of CmoCh06G010710 vs. TrEMBL
Match: A0A0B0PFR1_GOSAR (Uncharacterized protein OS=Gossypium arboreum GN=F383_09698 PE=4 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 7.9e-16 Identity = 50/63 (79.37%), Postives = 54/63 (85.71%), Query Frame = 1
BLAST of CmoCh06G010710 vs. TAIR10
Match: AT3G61640.1 (AT3G61640.1 arabinogalactan protein 20) HSP 1 Score: 79.7 bits (195), Expect = 9.2e-16 Identity = 44/64 (68.75%), Postives = 51/64 (79.69%), Query Frame = 1
BLAST of CmoCh06G010710 vs. TAIR10
Match: AT2G46330.1 (AT2G46330.1 arabinogalactan protein 16) HSP 1 Score: 77.8 bits (190), Expect = 3.5e-15 Identity = 44/66 (66.67%), Postives = 51/66 (77.27%), Query Frame = 1
BLAST of CmoCh06G010710 vs. TAIR10
Match: AT5G24105.1 (AT5G24105.1 arabinogalactan protein 41) HSP 1 Score: 73.6 bits (179), Expect = 6.6e-14 Identity = 41/59 (69.49%), Postives = 47/59 (79.66%), Query Frame = 1
BLAST of CmoCh06G010710 vs. TAIR10
Match: AT5G53250.1 (AT5G53250.1 arabinogalactan protein 22) HSP 1 Score: 66.2 bits (160), Expect = 1.1e-11 Identity = 35/52 (67.31%), Postives = 41/52 (78.85%), Query Frame = 1
BLAST of CmoCh06G010710 vs. NCBI nr
Match: gi|449432096|ref|XP_004133836.1| (PREDICTED: arabinogalactan peptide 20 [Cucumis sativus]) HSP 1 Score: 106.3 bits (264), Expect = 2.6e-20 Identity = 60/78 (76.92%), Postives = 64/78 (82.05%), Query Frame = 1
BLAST of CmoCh06G010710 vs. NCBI nr
Match: gi|590721494|ref|XP_007051629.1| (Arabinogalactan protein 20 [Theobroma cacao]) HSP 1 Score: 95.5 bits (236), Expect = 4.6e-17 Identity = 52/70 (74.29%), Postives = 57/70 (81.43%), Query Frame = 1
BLAST of CmoCh06G010710 vs. NCBI nr
Match: gi|823187080|ref|XP_012490068.1| (PREDICTED: arabinogalactan peptide 20-like [Gossypium raimondii]) HSP 1 Score: 92.0 bits (227), Expect = 5.1e-16 Identity = 50/64 (78.12%), Postives = 55/64 (85.94%), Query Frame = 1
BLAST of CmoCh06G010710 vs. NCBI nr
Match: gi|728850111|gb|KHG29554.1| (hypothetical protein F383_05303 [Gossypium arboreum]) HSP 1 Score: 91.3 bits (225), Expect = 8.7e-16 Identity = 50/69 (72.46%), Postives = 55/69 (79.71%), Query Frame = 1
BLAST of CmoCh06G010710 vs. NCBI nr
Match: gi|728844337|gb|KHG23780.1| (hypothetical protein F383_09698 [Gossypium arboreum]) HSP 1 Score: 90.9 bits (224), Expect = 1.1e-15 Identity = 50/63 (79.37%), Postives = 54/63 (85.71%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|