MELO3C028243.1 (mRNA) Melon (DHL92) v4

Overview


Name	MELO3C028243.1
Type	mRNA
Organism	Cucumis melo cv. DHL92 (Melon (DHL92) v4)
Description	Unknown protein
Location	chr08: 15750753 .. 15750990 (-)
Sequence length	238
RNA-Seq Expression	MELO3C028243.1
Synteny	MELO3C028243.1

Sequences

The following sequences are available for this feature:

Gene sequence (with intron)

Legend: exonfive_prime_UTRCDSpolypeptidethree_prime_UTR

Hold the cursor over a type above to highlight its positions in the sequence below.

CTTCAAACACAAACCTCGGAGCCGGCCGTAGTAAAGCCGAACCACCCTCCCAGCCGCGCCGCGTCTGCAAGCCGAAGCCGGAGCTCGCCGAGACAGCCGAAGCCAATCAGCCGCGCGTCTGCAAGTCGAAACTGAGCCGTCGCCGAGCTTCCAGCCGCGTCGGAAGAGTCGATCAAGCCGATCCGCGCAGCCGAGCGCCGTGTCTGCAGCCGAACTCGCCGTGCCGCGTCGATCTGAG

mRNA sequence

CTTCAAACACAAACCTCGGAGCCGGCCGTAGTAAAGCCGAACCACCCTCCCAGCCGCGCCGCGTCTGCAAGCCGAAGCCGGAGCTCGCCGAGACAGCCGAAGCCAATCAGCCGCGCGTCTGCAAGTCGAAACTGAGCCGTCGCCGAGCTTCCAGCCGCGTCGGAAGAGTCGATCAAGCCGATCCGCGCAGCCGAGCGCCGTGTCTGCAGCCGAACTCGCCGTGCCGCGTCGATCTGAG

Coding sequence (CDS)

TCAAACACAAACCTCGGAGCCGGCCGTAGTAAAGCCGAACCACCCTCCCAGCCGCGCCGCGTCTGCAAGCCGAAGCCGGAGCTCGCCGAGACAGCCGAAGCCAATCAGCCGCGCGTCTGCAAGTCGAAACTGAGCCGTCGCCGAGCTTCCAGCCGCGTCGGAAGAGTCGATCAAGCCGATCCGCGCAGCCGAGCGCCGTGTCTGCAGCCGAACTCGCCGTGCCGCGTCGATCTG

Protein sequence

SNTNLGAGRSKAEPPSQPRRVCKPKPELAETAEANQPRVCKSKLSRRRASSRVGRVDQADPRSRAPCLQPNSPCRVDL

Homology

The following BLAST results are available for this feature:

BLAST of MELO3C028243.1 vs.


Match Name	E-value	Identity	Description

BLAST of MELO3C028243.1 vs.


Match Name	E-value	Identity	Description

BLAST of MELO3C028243.1 vs.


Match Name	E-value	Identity	Description

BLAST of MELO3C028243.1 vs.


Match Name	E-value	Identity	Description

InterPro

Analysis Name: InterPro Annotations of Melon (DHL92) v4
Date Performed: 2022-08-06


IPR Term	IPR Description	Source	Source Term	Source Description	Alignment
None	No IPR available	MOBIDB_LITE	mobidb-lite	disorder_prediction	coord: 1..78

Relationships

This mRNA is a part of the following gene feature(s):


Feature Name	Unique Name	Type
MELO3C028243	MELO3C028243	gene

The following exon feature(s) are a part of this mRNA:


Feature Name	Unique Name	Type
MELO3C028243.1:exon:237793	MELO3C028243.1:exon:237793	exon

The following three_prime_UTR feature(s) are a part of this mRNA:


Feature Name	Unique Name	Type
MELO3C028243.1:three_prime_utr	MELO3C028243.1:three_prime_utr	three_prime_UTR

The following CDS feature(s) are a part of this mRNA:


Feature Name	Unique Name	Type
MELO3C028243.1:cds	MELO3C028243.1:cds	CDS

The following five_prime_UTR feature(s) are a part of this mRNA:


Feature Name	Unique Name	Type
MELO3C028243.1:five_prime_utr	MELO3C028243.1:five_prime_utr	five_prime_UTR

The following polypeptide feature(s) derives from this mRNA:


Feature Name	Unique Name	Type
MELO3C028243.1	MELO3C028243.1-protein	polypeptide