MELO3C012006.jh1.t1 (mRNA) Melon (Harukei-3) v1.41

Overview


Name	MELO3C012006.jh1.t1
Type	mRNA
Organism	Cucumis melo var. reticulatus cv. Harukei-3 (Melon (Harukei-3) v1.41)
Description	Unknown protein
Location	chr10: 3377516 .. 3377674 (-)
Sequence length	159
RNA-Seq Expression	MELO3C012006.jh1.t1
Synteny	MELO3C012006.jh1.t1

Sequences

The following sequences are available for this feature:

Gene sequence (with intron)

Legend: exonCDSpolypeptidestart_codonstop_codon

Hold the cursor over a type above to highlight its positions in the sequence below.

ATGAAGTCACGAAAGAGCGGGAAAAGCTGTTTAGCGGCTCGTGGTCGACGGAAATTGGGAAGAACAGAGGAAGAGAGAAAAATTGAAATGGACACCCGTCTTTCTTCGCCGATCCAGTCACCGATCGAAGGCAAGATAGCCGATAGATTGGAGAGTTGA

mRNA sequence

ATGAAGTCACGAAAGAGCGGGAAAAGCTGTTTAGCGGCTCGTGGTCGACGGAAATTGGGAAGAACAGAGGAAGAGAGAAAAATTGAAATGGACACCCGTCTTTCTTCGCCGATCCAGTCACCGATCGAAGGCAAGATAGCCGATAGATTGGAGAGTTGA

Coding sequence (CDS)

ATGAAGTCACGAAAGAGCGGGAAAAGCTGTTTAGCGGCTCGTGGTCGACGGAAATTGGGAAGAACAGAGGAAGAGAGAAAAATTGAAATGGACACCCGTCTTTCTTCGCCGATCCAGTCACCGATCGAAGGCAAGATAGCCGATAGATTGGAGAGTTGA

Protein sequence

MKSRKSGKSCLAARGRRKLGRTEEERKIEMDTRLSSPIQSPIEGKIADRLES

Homology

The following BLAST results are available for this feature:

BLAST of MELO3C012006.jh1.t1 vs.


Match Name	E-value	Identity	Description

BLAST of MELO3C012006.jh1.t1 vs.


Match Name	E-value	Identity	Description

BLAST of MELO3C012006.jh1.t1 vs.


Match Name	E-value	Identity	Description

BLAST of MELO3C012006.jh1.t1 vs.


Match Name	E-value	Identity	Description

InterPro

Analysis Name: InterPro Annotations of Melon (Harukei-3) v1.41
Date Performed: 2021-10-25


IPR Term	IPR Description	Source	Source Term	Source Description	Alignment
None	No IPR available	MOBIDB_LITE	mobidb-lite	disorder_prediction	coord: 1..52
None	No IPR available	MOBIDB_LITE	mobidb-lite	disorder_prediction	coord: 1..15
None	No IPR available	MOBIDB_LITE	mobidb-lite	disorder_prediction	coord: 16..32

Relationships

This mRNA is a part of the following gene feature(s):


Feature Name	Unique Name	Type
MELO3C012006.jh1	MELO3C012006.jh1	gene

The following exon feature(s) are a part of this mRNA:


Feature Name	Unique Name	Type
MELO3C012006.jh1.t1.exon	MELO3C012006.jh1.t1.exon	exon

The following stop_codon feature(s) are a part of this mRNA:


Feature Name	Unique Name	Type
MELO3C012006.jh1.t1.stop_codon	MELO3C012006.jh1.t1.stop_codon	stop_codon

The following CDS feature(s) are a part of this mRNA:


Feature Name	Unique Name	Type
MELO3C012006.jh1.t1.cds	MELO3C012006.jh1.t1.cds	CDS

The following start_codon feature(s) are a part of this mRNA:


Feature Name	Unique Name	Type
MELO3C012006.jh1.t1.start_codon	MELO3C012006.jh1.t1.start_codon	start_codon

The following polypeptide feature(s) derives from this mRNA:


Feature Name	Unique Name	Type
MELO3C012006.jh1.t1	MELO3C012006.jh1.t1-protein	polypeptide