Sgr022333 (gene) Monk fruit (Qingpiguo) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGACGCTGTAGATGAATCATCGCCGGTCCCGGAATCGGAGGTGGATGATCCGACGACAGAGGATGATCTCGATTCTACGGTTCTCGATCTCACCAGCTTTCAGCTCCACGACCTCGACTCTATCGAGCTGCCTTCAAGTTTAACGGAATTGGACCTGACGGCGAATCGACTTTCGAGTTTGGACCCTAGGATTGGAGAGCTCTCGAACCTGAAGAAGCTCTTTCTTCAGCAGAATCTCATCAATGATGCTGCAGCTGAATCGCTTTCTCGCTGGAACGCGCTATCAGGTCTCGAG ATGGACGCTGTAGATGAATCATCGCCGGTCCCGGAATCGGAGGTGGATGATCCGACGACAGAGGATGATCTCGATTCTACGGTTCTCGATCTCACCAGCTTTCAGCTCCACGACCTCGACTCTATCGAGCTGCCTTCAAGTTTAACGGAATTGGACCTGACGGCGAATCGACTTTCGAGTTTGGACCCTAGGATTGGAGAGCTCTCGAACCTGAAGAAGCTCTTTCTTCAGCAGAATCTCATCAATGATGCTGCAGCTGAATCGCTTTCTCGCTGGAACGCGCTATCAGGTCTCGAG ATGGACGCTGTAGATGAATCATCGCCGGTCCCGGAATCGGAGGTGGATGATCCGACGACAGAGGATGATCTCGATTCTACGGTTCTCGATCTCACCAGCTTTCAGCTCCACGACCTCGACTCTATCGAGCTGCCTTCAAGTTTAACGGAATTGGACCTGACGGCGAATCGACTTTCGAGTTTGGACCCTAGGATTGGAGAGCTCTCGAACCTGAAGAAGCTCTTTCTTCAGCAGAATCTCATCAATGATGCTGCAGCTGAATCGCTTTCTCGCTGGAACGCGCTATCAGGTCTCGAG MDAVDESSPVPESEVDDPTTEDDLDSTVLDLTSFQLHDLDSIELPSSLTELDLTANRLSSLDPRIGELSNLKKLFLQQNLINDAAAESLSRWNALSGLE Homology
BLAST of Sgr022333 vs. NCBI nr
Match: XP_022154721.1 (protein phosphatase 1 regulatory subunit pprA [Momordica charantia] >XP_022154723.1 protein phosphatase 1 regulatory subunit pprA [Momordica charantia] >XP_022154724.1 protein phosphatase 1 regulatory subunit pprA [Momordica charantia]) HSP 1 Score: 164.5 bits (415), Expect = 4.8e-37 Identity = 88/99 (88.89%), Postives = 94/99 (94.95%), Query Frame = 0
BLAST of Sgr022333 vs. NCBI nr
Match: XP_022999515.1 (protein phosphatase 1 regulatory inhibitor subunit PPP1R7 homolog [Cucurbita maxima]) HSP 1 Score: 149.8 bits (377), Expect = 1.2e-32 Identity = 85/99 (85.86%), Postives = 88/99 (88.89%), Query Frame = 0
BLAST of Sgr022333 vs. NCBI nr
Match: XP_022946403.1 (protein phosphatase 1 regulatory inhibitor subunit PPP1R7 homolog [Cucurbita moschata]) HSP 1 Score: 145.2 bits (365), Expect = 3.0e-31 Identity = 83/99 (83.84%), Postives = 86/99 (86.87%), Query Frame = 0
BLAST of Sgr022333 vs. NCBI nr
Match: XP_023547162.1 (protein phosphatase 1 regulatory inhibitor subunit PPP1R7 homolog [Cucurbita pepo subsp. pepo] >XP_023547163.1 protein phosphatase 1 regulatory inhibitor subunit PPP1R7 homolog [Cucurbita pepo subsp. pepo]) HSP 1 Score: 145.2 bits (365), Expect = 3.0e-31 Identity = 83/99 (83.84%), Postives = 86/99 (86.87%), Query Frame = 0
BLAST of Sgr022333 vs. NCBI nr
Match: KAG6599471.1 (Protein phosphatase 1 regulatory inhibitor subunit PPP1R7-like protein, partial [Cucurbita argyrosperma subsp. sororia] >KAG7030449.1 Protein phosphatase 1 regulatory subunit pprA [Cucurbita argyrosperma subsp. argyrosperma]) HSP 1 Score: 144.8 bits (364), Expect = 3.9e-31 Identity = 83/99 (83.84%), Postives = 86/99 (86.87%), Query Frame = 0
BLAST of Sgr022333 vs. ExPASy Swiss-Prot
Match: Q84WJ9 (Protein phosphatase 1 regulatory inhibitor subunit PPP1R7 homolog OS=Arabidopsis thaliana OX=3702 GN=At5g19680 PE=1 SV=1) HSP 1 Score: 99.8 bits (247), Expect = 1.9e-20 Identity = 54/84 (64.29%), Postives = 65/84 (77.38%), Query Frame = 0
BLAST of Sgr022333 vs. ExPASy TrEMBL
Match: A0A6J1DN03 (protein phosphatase 1 regulatory subunit pprA OS=Momordica charantia OX=3673 GN=LOC111021907 PE=4 SV=1) HSP 1 Score: 164.5 bits (415), Expect = 2.3e-37 Identity = 88/99 (88.89%), Postives = 94/99 (94.95%), Query Frame = 0
BLAST of Sgr022333 vs. ExPASy TrEMBL
Match: A0A6J1KFL4 (protein phosphatase 1 regulatory inhibitor subunit PPP1R7 homolog OS=Cucurbita maxima OX=3661 GN=LOC111493850 PE=4 SV=1) HSP 1 Score: 149.8 bits (377), Expect = 5.9e-33 Identity = 85/99 (85.86%), Postives = 88/99 (88.89%), Query Frame = 0
BLAST of Sgr022333 vs. ExPASy TrEMBL
Match: A0A6J1G3P9 (protein phosphatase 1 regulatory inhibitor subunit PPP1R7 homolog OS=Cucurbita moschata OX=3662 GN=LOC111450470 PE=4 SV=1) HSP 1 Score: 145.2 bits (365), Expect = 1.4e-31 Identity = 83/99 (83.84%), Postives = 86/99 (86.87%), Query Frame = 0
BLAST of Sgr022333 vs. ExPASy TrEMBL
Match: A0A5D3CKJ2 (Protein phosphatase 1 regulatory subunit pprA OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold332G00500 PE=4 SV=1) HSP 1 Score: 141.4 bits (355), Expect = 2.1e-30 Identity = 80/99 (80.81%), Postives = 87/99 (87.88%), Query Frame = 0
BLAST of Sgr022333 vs. ExPASy TrEMBL
Match: A0A5A7V2Q2 (Protein phosphatase 1 regulatory subunit pprA OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold41G00950 PE=4 SV=1) HSP 1 Score: 141.4 bits (355), Expect = 2.1e-30 Identity = 80/99 (80.81%), Postives = 87/99 (87.88%), Query Frame = 0
BLAST of Sgr022333 vs. TAIR 10
Match: AT5G19680.1 (Leucine-rich repeat (LRR) family protein ) HSP 1 Score: 99.8 bits (247), Expect = 1.3e-21 Identity = 54/84 (64.29%), Postives = 65/84 (77.38%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Monk fruit (Qingpiguo) v1
Date Performed: 2022-08-01
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|