Sed0017454 (gene) Chayote v1
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGATAAATCCAAGCGACTCCTTCTTAAATCCAAACGATCTTTTCGTAAGCGTTTGCCCCCGATTCAATCGGGGGATCGAATTGATTATAGAAACATGAGTTTAATTAGTCGATTTATTAGTGAACAAGGAAAAATATTATCTAGACGGGTAAATAGATTGACCTTAAAACAGCAACGCTTAATTACTATTGCTATAAAACAAGCTCGTATTTTATCTTTGTTACCTTTTCTTAATAATGAGAAACAATTTGAAAGAAGGGAGTCGACCGCTAGAACTATTGGTCTTAGAACCAGGAATAAATAG ATGGATAAATCCAAGCGACTCCTTCTTAAATCCAAACGATCTTTTCGTAAGCGTTTGCCCCCGATTCAATCGGGGGATCGAATTGATTATAGAAACATGAGTTTAATTAGTCGATTTATTAGTGAACAAGGAAAAATATTATCTAGACGGGTAAATAGATTGACCTTAAAACAGCAACGCTTAATTACTATTGCTATAAAACAAGCTCGTATTTTATCTTTGTTACCTTTTCTTAATAATGAGAAACAATTTGAAAGAAGGGAGTCGACCGCTAGAACTATTGGTCTTAGAACCAGGAATAAATAG ATGGATAAATCCAAGCGACTCCTTCTTAAATCCAAACGATCTTTTCGTAAGCGTTTGCCCCCGATTCAATCGGGGGATCGAATTGATTATAGAAACATGAGTTTAATTAGTCGATTTATTAGTGAACAAGGAAAAATATTATCTAGACGGGTAAATAGATTGACCTTAAAACAGCAACGCTTAATTACTATTGCTATAAAACAAGCTCGTATTTTATCTTTGTTACCTTTTCTTAATAATGAGAAACAATTTGAAAGAAGGGAGTCGACCGCTAGAACTATTGGTCTTAGAACCAGGAATAAATAG MDKSKRLLLKSKRSFRKRLPPIQSGDRIDYRNMSLISRFISEQGKILSRRVNRLTLKQQRLITIAIKQARILSLLPFLNNEKQFERRESTARTIGLRTRNK Homology
BLAST of Sed0017454 vs. NCBI nr
Match: YP_009945439.1 (ribosomal protein S18 [Sechium edule] >QIT04155.1 ribosomal protein S18 [Sechium edule] >QOE55969.1 ribosomal protein S18 [Sechium edule]) HSP 1 Score: 186.4 bits (472), Expect = 1.2e-43 Identity = 101/101 (100.00%), Postives = 101/101 (100.00%), Query Frame = 0
BLAST of Sed0017454 vs. NCBI nr
Match: YP_009317408.1 (ribosomal protein S18 [Coccinia grandis] >YP_009525208.1 ribosomal protein S18 [Hodgsonia macrocarpa] >YP_009560857.1 ribosomal protein S18 [Trichosanthes kirilowii] >YP_009751675.1 ribosomal protein S18 [Hodgsonia heteroclita] >YP_009751928.1 ribosomal protein S18 [Cyclanthera pedata] >YP_009752265.1 ribosomal protein S18 [Trichosanthes baviensis] >YP_009752434.1 ribosomal protein S18 [Trichosanthes tricuspidata] >YP_009752518.1 ribosomal protein S18 [Trichosanthes tubiflora] >YP_009752603.1 ribosomal protein S18 [Trichosanthes homophylla] >YP_009753196.1 ribosomal protein S18 [Trichosanthes truncata] >YP_009753642.1 ribosomal protein S18 [Trichosanthes wallichiana] >YP_009753727.1 ribosomal protein S18 [Trichosanthes nervifolia] >YP_009753811.1 ribosomal protein S18 [Trichosanthes pilosa] >QJD26493.1 ribosomal protein S18 [Trichosanthes kirilowii var. japonica] >QJD26667.1 ribosomal protein S18 [Trichosanthes rosthornii] >AOX48766.1 ribosomal protein S18 [Coccinia grandis] >AOX48851.1 ribosomal protein S18 [Coccinia grandis] >AXR94577.1 ribosomal protein S18 [Hodgsonia macrocarpa]) HSP 1 Score: 184.1 bits (466), Expect = 5.9e-43 Identity = 100/101 (99.01%), Postives = 100/101 (99.01%), Query Frame = 0
BLAST of Sed0017454 vs. NCBI nr
Match: YP_009456168.1 (ribosomal protein S18 [Lagenaria siceraria] >YP_009674413.1 ribosomal protein S18 [Siraitia grosvenorii] >YP_009738223.1 ribosomal protein S18 [Siraitia siamensis] >YP_009751844.1 ribosomal protein S18 [Indofevillea khasiana] >YP_009752097.1 ribosomal protein S18 [Dendrosicyos socotranus] >YP_009752688.1 ribosomal protein S18 [Ampelosycios humblotii] >YP_009752942.1 ribosomal protein S18 [Momordica sessilifolia] >YP_009753111.1 ribosomal protein S18 [Corallocarpus boehmii] >YP_009753280.1 ribosomal protein S18 [Nothoalsomitra suberosa] >YP_010131116.1 ribosomal protein S18 [Benincasa hispida] >QIT04072.1 ribosomal protein S18 [Luffa aegyptiaca] >QKX48495.1 ribosomal protein S18 [Luffa acutangula] >QNM38553.1 ribosomal protein S18 [Lagenaria siceraria var. microcarpa] >AHM88716.1 ribosomal protein S18 [Lagenaria siceraria] >AHM88775.1 ribosomal protein S18 [Lagenaria siceraria]) HSP 1 Score: 183.0 bits (463), Expect = 1.3e-42 Identity = 99/101 (98.02%), Postives = 100/101 (99.01%), Query Frame = 0
BLAST of Sed0017454 vs. NCBI nr
Match: YP_009753896.1 (ribosomal protein S18 [Trichosanthes lobata] >QIT05844.1 ribosomal protein S18 [Trichosanthes lobata]) HSP 1 Score: 182.6 bits (462), Expect = 1.7e-42 Identity = 99/101 (98.02%), Postives = 99/101 (98.02%), Query Frame = 0
BLAST of Sed0017454 vs. NCBI nr
Match: QJR52978.1 (ribosomal protein S18 [Herpetospermum pedunculosum]) HSP 1 Score: 182.6 bits (462), Expect = 1.7e-42 Identity = 98/101 (97.03%), Postives = 100/101 (99.01%), Query Frame = 0
BLAST of Sed0017454 vs. ExPASy Swiss-Prot
Match: A0ZZ57 (30S ribosomal protein S18, chloroplastic OS=Gossypium barbadense OX=3634 GN=rps18 PE=3 SV=1) HSP 1 Score: 175.6 bits (444), Expect = 2.8e-43 Identity = 95/101 (94.06%), Postives = 96/101 (95.05%), Query Frame = 0
BLAST of Sed0017454 vs. ExPASy Swiss-Prot
Match: Q0ZIZ8 (30S ribosomal protein S18, chloroplastic OS=Vitis vinifera OX=29760 GN=rps18 PE=3 SV=1) HSP 1 Score: 174.5 bits (441), Expect = 6.2e-43 Identity = 95/101 (94.06%), Postives = 96/101 (95.05%), Query Frame = 0
BLAST of Sed0017454 vs. ExPASy Swiss-Prot
Match: Q0G9U0 (30S ribosomal protein S18, chloroplastic OS=Daucus carota OX=4039 GN=rps18 PE=3 SV=1) HSP 1 Score: 173.3 bits (438), Expect = 1.4e-42 Identity = 94/101 (93.07%), Postives = 95/101 (94.06%), Query Frame = 0
BLAST of Sed0017454 vs. ExPASy Swiss-Prot
Match: Q2L928 (30S ribosomal protein S18, chloroplastic OS=Gossypium hirsutum OX=3635 GN=rps18 PE=3 SV=1) HSP 1 Score: 173.3 bits (438), Expect = 1.4e-42 Identity = 94/101 (93.07%), Postives = 95/101 (94.06%), Query Frame = 0
BLAST of Sed0017454 vs. ExPASy Swiss-Prot
Match: B1A957 (30S ribosomal protein S18, chloroplastic OS=Carica papaya OX=3649 GN=rps18 PE=3 SV=1) HSP 1 Score: 172.6 bits (436), Expect = 2.3e-42 Identity = 93/101 (92.08%), Postives = 95/101 (94.06%), Query Frame = 0
BLAST of Sed0017454 vs. ExPASy TrEMBL
Match: A0A6H0EQL7 (30S ribosomal protein S18, chloroplastic OS=Sechium edule OX=184140 GN=rps18 PE=3 SV=1) HSP 1 Score: 186.4 bits (472), Expect = 5.8e-44 Identity = 101/101 (100.00%), Postives = 101/101 (100.00%), Query Frame = 0
BLAST of Sed0017454 vs. ExPASy TrEMBL
Match: A0A410HFA4 (30S ribosomal protein S18, chloroplastic OS=Trichosanthes kirilowii OX=3677 GN=rps18 PE=3 SV=1) HSP 1 Score: 184.1 bits (466), Expect = 2.9e-43 Identity = 100/101 (99.01%), Postives = 100/101 (99.01%), Query Frame = 0
BLAST of Sed0017454 vs. ExPASy TrEMBL
Match: A0A6M3RTS7 (30S ribosomal protein S18, chloroplastic OS=Trichosanthes kirilowii var. japonica OX=61011 GN=rps18 PE=3 SV=1) HSP 1 Score: 184.1 bits (466), Expect = 2.9e-43 Identity = 100/101 (99.01%), Postives = 100/101 (99.01%), Query Frame = 0
BLAST of Sed0017454 vs. ExPASy TrEMBL
Match: A0A2Z2CGJ8 (30S ribosomal protein S18, chloroplastic OS=Coccinia grandis OX=387127 GN=rps18 PE=3 SV=1) HSP 1 Score: 184.1 bits (466), Expect = 2.9e-43 Identity = 100/101 (99.01%), Postives = 100/101 (99.01%), Query Frame = 0
BLAST of Sed0017454 vs. ExPASy TrEMBL
Match: A0A346QNH8 (30S ribosomal protein S18, chloroplastic OS=Hodgsonia macrocarpa OX=2184935 GN=rps18 PE=3 SV=1) HSP 1 Score: 184.1 bits (466), Expect = 2.9e-43 Identity = 100/101 (99.01%), Postives = 100/101 (99.01%), Query Frame = 0
BLAST of Sed0017454 vs. TAIR 10
Match: ATCG00650.1 (ribosomal protein S18 ) HSP 1 Score: 166.8 bits (421), Expect = 9.1e-42 Identity = 90/101 (89.11%), Postives = 94/101 (93.07%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Chayote (edule) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|