PI0012128 (gene) Melon (PI 482460) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGATAAATCCAAGCGACTCTTTCTTAAATCCAAACGATCTTTTCGTAGGCGTTTGCCCCCGATCCAATCGGGGGATCGAATTGATTATAGAAACATGAGTTTAATTAGTCGATTTATTAGTGAACAAGGAAAAATATTATCTAGACGGGTAAATAGATTGACCTTAAAACAGCAACGCTTAATTACTATTGCTATAAAACAAGCTCGTATTTTATCTTTGTTACCTTTTCTTAATAATGAGAAACAATTTGAAAGAAGCGAGTCGACCGCTAGAACTATTGGTCTTAGAACCAGGAATAAATAG ATGGATAAATCCAAGCGACTCTTTCTTAAATCCAAACGATCTTTTCGTAGGCGTTTGCCCCCGATCCAATCGGGGGATCGAATTGATTATAGAAACATGAGTTTAATTAGTCGATTTATTAGTGAACAAGGAAAAATATTATCTAGACGGGTAAATAGATTGACCTTAAAACAGCAACGCTTAATTACTATTGCTATAAAACAAGCTCGTATTTTATCTTTGTTACCTTTTCTTAATAATGAGAAACAATTTGAAAGAAGCGAGTCGACCGCTAGAACTATTGGTCTTAGAACCAGGAATAAATAG ATGGATAAATCCAAGCGACTCTTTCTTAAATCCAAACGATCTTTTCGTAGGCGTTTGCCCCCGATCCAATCGGGGGATCGAATTGATTATAGAAACATGAGTTTAATTAGTCGATTTATTAGTGAACAAGGAAAAATATTATCTAGACGGGTAAATAGATTGACCTTAAAACAGCAACGCTTAATTACTATTGCTATAAAACAAGCTCGTATTTTATCTTTGTTACCTTTTCTTAATAATGAGAAACAATTTGAAAGAAGCGAGTCGACCGCTAGAACTATTGGTCTTAGAACCAGGAATAAATAG MDKSKRLFLKSKRSFRRRLPPIQSGDRIDYRNMSLISRFISEQGKILSRRVNRLTLKQQRLITIAIKQARILSLLPFLNNEKQFERSESTARTIGLRTRNK Homology
BLAST of PI0012128 vs. ExPASy Swiss-Prot
Match: A0ZZ57 (30S ribosomal protein S18, chloroplastic OS=Gossypium barbadense OX=3634 GN=rps18 PE=3 SV=1) HSP 1 Score: 181.8 bits (460), Expect = 3.9e-45 Identity = 98/101 (97.03%), Postives = 98/101 (97.03%), Query Frame = 0
BLAST of PI0012128 vs. ExPASy Swiss-Prot
Match: Q2L928 (30S ribosomal protein S18, chloroplastic OS=Gossypium hirsutum OX=3635 GN=rps18 PE=3 SV=1) HSP 1 Score: 179.5 bits (454), Expect = 1.9e-44 Identity = 97/101 (96.04%), Postives = 97/101 (96.04%), Query Frame = 0
BLAST of PI0012128 vs. ExPASy Swiss-Prot
Match: Q0ZIZ8 (30S ribosomal protein S18, chloroplastic OS=Vitis vinifera OX=29760 GN=rps18 PE=3 SV=1) HSP 1 Score: 179.5 bits (454), Expect = 1.9e-44 Identity = 97/101 (96.04%), Postives = 98/101 (97.03%), Query Frame = 0
BLAST of PI0012128 vs. ExPASy Swiss-Prot
Match: B1A957 (30S ribosomal protein S18, chloroplastic OS=Carica papaya OX=3649 GN=rps18 PE=3 SV=1) HSP 1 Score: 178.7 bits (452), Expect = 3.3e-44 Identity = 96/101 (95.05%), Postives = 97/101 (96.04%), Query Frame = 0
BLAST of PI0012128 vs. ExPASy Swiss-Prot
Match: Q0G9U0 (30S ribosomal protein S18, chloroplastic OS=Daucus carota OX=4039 GN=rps18 PE=3 SV=1) HSP 1 Score: 178.3 bits (451), Expect = 4.3e-44 Identity = 96/101 (95.05%), Postives = 97/101 (96.04%), Query Frame = 0
BLAST of PI0012128 vs. ExPASy TrEMBL
Match: A0A120L1C7 (30S ribosomal protein S18, chloroplastic OS=Gynostemma pentaphyllum OX=182084 GN=rps18 PE=3 SV=1) HSP 1 Score: 186.4 bits (472), Expect = 5.8e-44 Identity = 100/101 (99.01%), Postives = 101/101 (100.00%), Query Frame = 0
BLAST of PI0012128 vs. ExPASy TrEMBL
Match: A0A291IBF4 (30S ribosomal protein S18, chloroplastic OS=Gynostemma burmanicum (nom. inval.) OX=1348122 GN=rps18 PE=3 SV=1) HSP 1 Score: 186.4 bits (472), Expect = 5.8e-44 Identity = 100/101 (99.01%), Postives = 101/101 (100.00%), Query Frame = 0
BLAST of PI0012128 vs. ExPASy TrEMBL
Match: A0A2L0WR51 (30S ribosomal protein S18, chloroplastic OS=Gynostemma compressum OX=1348125 GN=rps18 PE=3 SV=1) HSP 1 Score: 186.4 bits (472), Expect = 5.8e-44 Identity = 100/101 (99.01%), Postives = 101/101 (100.00%), Query Frame = 0
BLAST of PI0012128 vs. ExPASy TrEMBL
Match: A0A291IB68 (30S ribosomal protein S18, chloroplastic OS=Gynostemma longipes OX=555431 GN=rps18 PE=3 SV=1) HSP 1 Score: 186.4 bits (472), Expect = 5.8e-44 Identity = 100/101 (99.01%), Postives = 101/101 (100.00%), Query Frame = 0
BLAST of PI0012128 vs. ExPASy TrEMBL
Match: A0A291IAQ8 (30S ribosomal protein S18, chloroplastic OS=Gynostemma caulopterum OX=1592219 GN=rps18 PE=3 SV=1) HSP 1 Score: 186.4 bits (472), Expect = 5.8e-44 Identity = 100/101 (99.01%), Postives = 101/101 (100.00%), Query Frame = 0
BLAST of PI0012128 vs. NCBI nr
Match: QTA71770.1 (ribosomal protein S18 [Coriaria nepalensis]) HSP 1 Score: 187.2 bits (474), Expect = 7.0e-44 Identity = 100/101 (99.01%), Postives = 101/101 (100.00%), Query Frame = 0
BLAST of PI0012128 vs. NCBI nr
Match: YP_009236302.1 (ribosomal protein S18 [Gynostemma pentaphyllum] >YP_009440179.1 ribosomal protein S18 [Gynostemma longipes] >YP_009440266.1 ribosomal protein S18 [Gynostemma burmanicum (nom. inval.)] >YP_009440353.1 ribosomal protein S18 [Gynostemma pubescens] >AMF84032.1 ribosomal protein S18 [Gynostemma pentaphyllum] >ANI25206.1 ribosomal protein S18 [Gynostemma pentaphyllum] >ART65016.1 ribosomal protein S18 [Gynostemma pentaphyllum] >ATG86943.1 ribosomal protein S18 [Gynostemma longipes] >ATG87030.1 ribosomal protein S18 [Gynostemma burmanicum (nom. inval.)]) HSP 1 Score: 186.4 bits (472), Expect = 1.2e-43 Identity = 100/101 (99.01%), Postives = 101/101 (100.00%), Query Frame = 0
BLAST of PI0012128 vs. NCBI nr
Match: YP_009439913.1 (ribosomal protein S18 [Gynostemma caulopterum] >YP_009468883.1 ribosomal protein S18 [Gynostemma compressum] >ATG86769.1 ribosomal protein S18 [Gynostemma caulopterum] >AVA29860.1 ribosomal protein S18 [Gynostemma compressum]) HSP 1 Score: 186.4 bits (472), Expect = 1.2e-43 Identity = 100/101 (99.01%), Postives = 101/101 (100.00%), Query Frame = 0
BLAST of PI0012128 vs. NCBI nr
Match: YP_009526324.1 (ribosomal protein S18 [Hemsleya lijiangensis] >YP_010119756.1 ribosomal protein S18 [Hemsleya zhejiangensis] >AXU40443.1 ribosomal protein S18 [Gomphogyne cissiformis var. villosa] >AXU40530.1 ribosomal protein S18 [Hemsleya lijiangensis] >QRC26963.1 ribosomal protein S18 [Hemsleya zhejiangensis]) HSP 1 Score: 185.7 bits (470), Expect = 2.0e-43 Identity = 100/101 (99.01%), Postives = 100/101 (99.01%), Query Frame = 0
BLAST of PI0012128 vs. NCBI nr
Match: YP_004072484.1 (ribosomal protein S18 [Corynocarpus laevigatus] >ADO60332.1 ribosomal protein S18 [Corynocarpus laevigatus]) HSP 1 Score: 185.3 bits (469), Expect = 2.7e-43 Identity = 100/101 (99.01%), Postives = 100/101 (99.01%), Query Frame = 0
BLAST of PI0012128 vs. TAIR 10
Match: ATCG00650.1 (ribosomal protein S18 ) HSP 1 Score: 172.9 bits (437), Expect = 1.3e-43 Identity = 93/101 (92.08%), Postives = 96/101 (95.05%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Melon (PI 482460) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|