Moc11g09660 (gene) Bitter gourd (OHB3-1) v2
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGCTTCATATAGCTCTGTTATGCACGAACCTGTCTCCTACTCTCAGGCCATCCATGTCTTCCGTGGTTAGCATGCTCGAAGGTAAAATTGCGATTGAAGTAGCGAACATCAAGTGCAACACAGCCGACCGAGATGCAAGGTTCAAAGCTTTCGAGAAGCTATCACAAGACAGCCAAACCAGCATTTCAACATCTTCGCAAGGCATTCAGATGCAGAGAAGCATGCTAATCGATGGACCATGGATTGACTCATCATCTACTTCTACCCAAAACAAGGACGAGGCTCGAGAGTATTCTTCAACCAGAAGTCTTCTTGGAGATTGA ATGCTTCATATAGCTCTGTTATGCACGAACCTGTCTCCTACTCTCAGGCCATCCATGTCTTCCGTGGTTAGCATGCTCGAAGGTAAAATTGCGATTGAAGTAGCGAACATCAAGTGCAACACAGCCGACCGAGATGCAAGGTTCAAAGCTTTCGAGAAGCTATCACAAGACAGCCAAACCAGCATTTCAACATCTTCGCAAGGCATTCAGATGCAGAGAAGCATGCTAATCGATGGACCATGGATTGACTCATCATCTACTTCTACCCAAAACAAGGACGAGGCTCGAGAGTATTCTTCAACCAGAAGTCTTCTTGGAGATTGA ATGCTTCATATAGCTCTGTTATGCACGAACCTGTCTCCTACTCTCAGGCCATCCATGTCTTCCGTGGTTAGCATGCTCGAAGGTAAAATTGCGATTGAAGTAGCGAACATCAAGTGCAACACAGCCGACCGAGATGCAAGGTTCAAAGCTTTCGAGAAGCTATCACAAGACAGCCAAACCAGCATTTCAACATCTTCGCAAGGCATTCAGATGCAGAGAAGCATGCTAATCGATGGACCATGGATTGACTCATCATCTACTTCTACCCAAAACAAGGACGAGGCTCGAGAGTATTCTTCAACCAGAAGTCTTCTTGGAGATTGA MLHIALLCTNLSPTLRPSMSSVVSMLEGKIAIEVANIKCNTADRDARFKAFEKLSQDSQTSISTSSQGIQMQRSMLIDGPWIDSSSTSTQNKDEAREYSSTRSLLGD Homology
BLAST of Moc11g09660 vs. NCBI nr
Match: XP_022136581.1 (LOW QUALITY PROTEIN: probable LRR receptor-like serine/threonine-protein kinase At1g53430 [Momordica charantia]) HSP 1 Score: 201.4 bits (511), Expect = 3.8e-48 Identity = 107/107 (100.00%), Postives = 107/107 (100.00%), Query Frame = 0
BLAST of Moc11g09660 vs. NCBI nr
Match: XP_022136550.1 (probable LRR receptor-like serine/threonine-protein kinase At1g53440 [Momordica charantia]) HSP 1 Score: 180.6 bits (457), Expect = 6.9e-42 Identity = 97/107 (90.65%), Postives = 101/107 (94.39%), Query Frame = 0
BLAST of Moc11g09660 vs. NCBI nr
Match: XP_022940757.1 (probable LRR receptor-like serine/threonine-protein kinase At1g53430 isoform X1 [Cucurbita moschata]) HSP 1 Score: 174.5 bits (441), Expect = 5.0e-40 Identity = 95/107 (88.79%), Postives = 97/107 (90.65%), Query Frame = 0
BLAST of Moc11g09660 vs. NCBI nr
Match: XP_023525945.1 (probable LRR receptor-like serine/threonine-protein kinase At1g53430 isoform X1 [Cucurbita pepo subsp. pepo]) HSP 1 Score: 174.5 bits (441), Expect = 5.0e-40 Identity = 95/107 (88.79%), Postives = 97/107 (90.65%), Query Frame = 0
BLAST of Moc11g09660 vs. NCBI nr
Match: KAG6607937.1 (putative LRR receptor-like serine/threonine-protein kinase, partial [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 174.5 bits (441), Expect = 5.0e-40 Identity = 95/107 (88.79%), Postives = 97/107 (90.65%), Query Frame = 0
BLAST of Moc11g09660 vs. ExPASy Swiss-Prot
Match: C0LGG8 (Probable LRR receptor-like serine/threonine-protein kinase At1g53430 OS=Arabidopsis thaliana OX=3702 GN=At1g53430 PE=1 SV=1) HSP 1 Score: 89.4 bits (220), Expect = 2.8e-17 Identity = 58/117 (49.57%), Postives = 74/117 (63.25%), Query Frame = 0
BLAST of Moc11g09660 vs. ExPASy Swiss-Prot
Match: C0LGG9 (Probable LRR receptor-like serine/threonine-protein kinase At1g53440 OS=Arabidopsis thaliana OX=3702 GN=At1g53440 PE=2 SV=2) HSP 1 Score: 87.8 bits (216), Expect = 8.0e-17 Identity = 55/116 (47.41%), Postives = 73/116 (62.93%), Query Frame = 0
BLAST of Moc11g09660 vs. ExPASy Swiss-Prot
Match: C0LGE0 (Probable LRR receptor-like serine/threonine-protein kinase At1g07650 OS=Arabidopsis thaliana OX=3702 GN=At1g07650 PE=1 SV=1) HSP 1 Score: 49.3 bits (116), Expect = 3.2e-05 Identity = 22/33 (66.67%), Postives = 30/33 (90.91%), Query Frame = 0
BLAST of Moc11g09660 vs. ExPASy Swiss-Prot
Match: C0LGG7 (Probable LRR receptor-like serine/threonine-protein kinase At1g53420 OS=Arabidopsis thaliana OX=3702 GN=At1g53420 PE=2 SV=2) HSP 1 Score: 45.1 bits (105), Expect = 6.0e-04 Identity = 27/71 (38.03%), Postives = 41/71 (57.75%), Query Frame = 0
BLAST of Moc11g09660 vs. ExPASy TrEMBL
Match: A0A6J1C3W4 (Non-specific serine/threonine protein kinase OS=Momordica charantia OX=3673 GN=LOC111008251 PE=4 SV=1) HSP 1 Score: 201.4 bits (511), Expect = 1.8e-48 Identity = 107/107 (100.00%), Postives = 107/107 (100.00%), Query Frame = 0
BLAST of Moc11g09660 vs. ExPASy TrEMBL
Match: A0A6J1C483 (Non-specific serine/threonine protein kinase OS=Momordica charantia OX=3673 GN=LOC111008221 PE=4 SV=1) HSP 1 Score: 180.6 bits (457), Expect = 3.4e-42 Identity = 97/107 (90.65%), Postives = 101/107 (94.39%), Query Frame = 0
BLAST of Moc11g09660 vs. ExPASy TrEMBL
Match: A0A6J1FQ71 (Non-specific serine/threonine protein kinase OS=Cucurbita moschata OX=3662 GN=LOC111446262 PE=4 SV=1) HSP 1 Score: 174.5 bits (441), Expect = 2.4e-40 Identity = 95/107 (88.79%), Postives = 97/107 (90.65%), Query Frame = 0
BLAST of Moc11g09660 vs. ExPASy TrEMBL
Match: A0A6J1FKH5 (Non-specific serine/threonine protein kinase OS=Cucurbita moschata OX=3662 GN=LOC111446262 PE=4 SV=1) HSP 1 Score: 174.5 bits (441), Expect = 2.4e-40 Identity = 95/107 (88.79%), Postives = 97/107 (90.65%), Query Frame = 0
BLAST of Moc11g09660 vs. ExPASy TrEMBL
Match: A0A6J1C7W8 (Non-specific serine/threonine protein kinase OS=Momordica charantia OX=3673 GN=LOC111008232 PE=4 SV=1) HSP 1 Score: 156.0 bits (393), Expect = 8.9e-35 Identity = 85/105 (80.95%), Postives = 93/105 (88.57%), Query Frame = 0
BLAST of Moc11g09660 vs. TAIR 10
Match: AT1G53430.1 (Leucine-rich repeat transmembrane protein kinase ) HSP 1 Score: 89.4 bits (220), Expect = 2.0e-18 Identity = 58/117 (49.57%), Postives = 74/117 (63.25%), Query Frame = 0
BLAST of Moc11g09660 vs. TAIR 10
Match: AT1G53430.2 (Leucine-rich repeat transmembrane protein kinase ) HSP 1 Score: 89.4 bits (220), Expect = 2.0e-18 Identity = 58/117 (49.57%), Postives = 74/117 (63.25%), Query Frame = 0
BLAST of Moc11g09660 vs. TAIR 10
Match: AT1G53440.1 (Leucine-rich repeat transmembrane protein kinase ) HSP 1 Score: 87.8 bits (216), Expect = 5.7e-18 Identity = 55/116 (47.41%), Postives = 73/116 (62.93%), Query Frame = 0
BLAST of Moc11g09660 vs. TAIR 10
Match: AT1G07650.1 (Leucine-rich repeat transmembrane protein kinase ) HSP 1 Score: 49.3 bits (116), Expect = 2.2e-06 Identity = 22/33 (66.67%), Postives = 30/33 (90.91%), Query Frame = 0
BLAST of Moc11g09660 vs. TAIR 10
Match: AT1G07650.2 (Leucine-rich repeat transmembrane protein kinase ) HSP 1 Score: 49.3 bits (116), Expect = 2.2e-06 Identity = 22/33 (66.67%), Postives = 30/33 (90.91%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (OHB3-1) v2
Date Performed: 2022-08-01
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|