Moc05g08670 (gene) Bitter gourd (OHB3-1) v2
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTAGAGCTTTTAACGGGAAAACAACCGTTCTCTTTTGCAAAAGATAAGGGCAAGAATCTACTAGAGTACTTCATTTCGTTGGAGACAAATAATCGACTTGATGAAATTCTAGATGTTTTAGTAGAAAGAGAGGCAAAGATAGAGGATGTTTATTGTGTTGCAAAGCTAGCCATTAGATGTTTGAGATTGAATGGGAAGAAAAGGCCTACCATGAAACAAGTATTTTTGGAATTAGAAGGAGTGAGGAAGCCCCAAGATTTAAATCAATCAAGTGAGAGTTTGACTATTCACAGTGCTAGTTGTAGCGATGAAGAGTTTATGGGTGACAGTATTGTATCTCTTGAAATTGAGACATTGTAA ATGGTAGAGCTTTTAACGGGAAAACAACCGTTCTCTTTTGCAAAAGATAAGGGCAAGAATCTACTAGAGTACTTCATTTCGTTGGAGACAAATAATCGACTTGATGAAATTCTAGATGTTTTAGTAGAAAGAGAGGCAAAGATAGAGGATGTTTATTGTGTTGCAAAGCTAGCCATTAGATGTTTGAGATTGAATGGGAAGAAAAGGCCTACCATGAAACAAGTATTTTTGGAATTAGAAGGAGTGAGGAAGCCCCAAGATTTAAATCAATCAAGTGAGAGTTTGACTATTCACAGTGCTAGTTGTAGCGATGAAGAGTTTATGGGTGACAGTATTGTATCTCTTGAAATTGAGACATTGTAA ATGGTAGAGCTTTTAACGGGAAAACAACCGTTCTCTTTTGCAAAAGATAAGGGCAAGAATCTACTAGAGTACTTCATTTCGTTGGAGACAAATAATCGACTTGATGAAATTCTAGATGTTTTAGTAGAAAGAGAGGCAAAGATAGAGGATGTTTATTGTGTTGCAAAGCTAGCCATTAGATGTTTGAGATTGAATGGGAAGAAAAGGCCTACCATGAAACAAGTATTTTTGGAATTAGAAGGAGTGAGGAAGCCCCAAGATTTAAATCAATCAAGTGAGAGTTTGACTATTCACAGTGCTAGTTGTAGCGATGAAGAGTTTATGGGTGACAGTATTGTATCTCTTGAAATTGAGACATTGTAA MVELLTGKQPFSFAKDKGKNLLEYFISLETNNRLDEILDVLVEREAKIEDVYCVAKLAIRCLRLNGKKRPTMKQVFLELEGVRKPQDLNQSSESLTIHSASCSDEEFMGDSIVSLEIETL Homology
BLAST of Moc05g08670 vs. NCBI nr
Match: XP_022152077.1 (wall-associated receptor kinase-like 1 [Momordica charantia]) HSP 1 Score: 116.7 bits (291), Expect = 1.4e-22 Identity = 62/110 (56.36%), Postives = 80/110 (72.73%), Query Frame = 0
BLAST of Moc05g08670 vs. NCBI nr
Match: XP_022152109.1 (lysM domain receptor-like kinase 4 [Momordica charantia]) HSP 1 Score: 116.7 bits (291), Expect = 1.4e-22 Identity = 55/88 (62.50%), Postives = 74/88 (84.09%), Query Frame = 0
BLAST of Moc05g08670 vs. NCBI nr
Match: XP_022152076.1 (wall-associated receptor kinase-like 1 [Momordica charantia]) HSP 1 Score: 116.7 bits (291), Expect = 1.4e-22 Identity = 67/126 (53.17%), Postives = 87/126 (69.05%), Query Frame = 0
BLAST of Moc05g08670 vs. NCBI nr
Match: XP_022152101.1 (wall-associated receptor kinase-like 1 [Momordica charantia]) HSP 1 Score: 116.3 bits (290), Expect = 1.8e-22 Identity = 62/102 (60.78%), Postives = 78/102 (76.47%), Query Frame = 0
BLAST of Moc05g08670 vs. NCBI nr
Match: XP_022152113.1 (wall-associated receptor kinase-like 1 [Momordica charantia]) HSP 1 Score: 113.6 bits (283), Expect = 1.2e-21 Identity = 63/112 (56.25%), Postives = 80/112 (71.43%), Query Frame = 0
BLAST of Moc05g08670 vs. ExPASy Swiss-Prot
Match: Q9S9M5 (Wall-associated receptor kinase-like 1 OS=Arabidopsis thaliana OX=3702 GN=WAKL1 PE=2 SV=1) HSP 1 Score: 76.6 bits (187), Expect = 2.1e-13 Identity = 40/96 (41.67%), Postives = 65/96 (67.71%), Query Frame = 0
BLAST of Moc05g08670 vs. ExPASy Swiss-Prot
Match: Q9SA25 (Wall-associated receptor kinase-like 8 OS=Arabidopsis thaliana OX=3702 GN=WAKL8 PE=2 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 1.0e-12 Identity = 40/92 (43.48%), Postives = 59/92 (64.13%), Query Frame = 0
BLAST of Moc05g08670 vs. ExPASy Swiss-Prot
Match: Q8RY17 (Wall-associated receptor kinase-like 22 OS=Arabidopsis thaliana OX=3702 GN=WAKL22 PE=2 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 3.0e-12 Identity = 42/107 (39.25%), Postives = 64/107 (59.81%), Query Frame = 0
BLAST of Moc05g08670 vs. ExPASy Swiss-Prot
Match: Q9S9M1 (Wall-associated receptor kinase-like 5 OS=Arabidopsis thaliana OX=3702 GN=WAKL5 PE=2 SV=2) HSP 1 Score: 72.4 bits (176), Expect = 3.9e-12 Identity = 37/96 (38.54%), Postives = 62/96 (64.58%), Query Frame = 0
BLAST of Moc05g08670 vs. ExPASy Swiss-Prot
Match: Q9S9M3 (Wall-associated receptor kinase-like 3 OS=Arabidopsis thaliana OX=3702 GN=WAKL3 PE=2 SV=2) HSP 1 Score: 68.2 bits (165), Expect = 7.4e-11 Identity = 39/96 (40.62%), Postives = 62/96 (64.58%), Query Frame = 0
BLAST of Moc05g08670 vs. ExPASy TrEMBL
Match: A0A6J1DF75 (wall-associated receptor kinase-like 1 OS=Momordica charantia OX=3673 GN=LOC111019879 PE=3 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 6.7e-23 Identity = 62/110 (56.36%), Postives = 80/110 (72.73%), Query Frame = 0
BLAST of Moc05g08670 vs. ExPASy TrEMBL
Match: A0A6J1DGJ3 (wall-associated receptor kinase-like 1 OS=Momordica charantia OX=3673 GN=LOC111019878 PE=4 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 6.7e-23 Identity = 67/126 (53.17%), Postives = 87/126 (69.05%), Query Frame = 0
BLAST of Moc05g08670 vs. ExPASy TrEMBL
Match: A0A6J1DF21 (lysM domain receptor-like kinase 4 OS=Momordica charantia OX=3673 GN=LOC111019898 PE=4 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 6.7e-23 Identity = 55/88 (62.50%), Postives = 74/88 (84.09%), Query Frame = 0
BLAST of Moc05g08670 vs. ExPASy TrEMBL
Match: A0A6J1DGL8 (wall-associated receptor kinase-like 1 OS=Momordica charantia OX=3673 GN=LOC111019885 PE=4 SV=1) HSP 1 Score: 116.3 bits (290), Expect = 8.7e-23 Identity = 62/102 (60.78%), Postives = 78/102 (76.47%), Query Frame = 0
BLAST of Moc05g08670 vs. ExPASy TrEMBL
Match: A0A6J1DDZ8 (wall-associated receptor kinase-like 1 OS=Momordica charantia OX=3673 GN=LOC111019904 PE=4 SV=1) HSP 1 Score: 113.6 bits (283), Expect = 5.7e-22 Identity = 63/112 (56.25%), Postives = 80/112 (71.43%), Query Frame = 0
BLAST of Moc05g08670 vs. TAIR 10
Match: AT1G16120.1 (wall associated kinase-like 1 ) HSP 1 Score: 76.6 bits (187), Expect = 1.5e-14 Identity = 40/96 (41.67%), Postives = 65/96 (67.71%), Query Frame = 0
BLAST of Moc05g08670 vs. TAIR 10
Match: AT1G16260.1 (Wall-associated kinase family protein ) HSP 1 Score: 74.3 bits (181), Expect = 7.3e-14 Identity = 40/92 (43.48%), Postives = 59/92 (64.13%), Query Frame = 0
BLAST of Moc05g08670 vs. TAIR 10
Match: AT1G16260.2 (Wall-associated kinase family protein ) HSP 1 Score: 74.3 bits (181), Expect = 7.3e-14 Identity = 40/92 (43.48%), Postives = 59/92 (64.13%), Query Frame = 0
BLAST of Moc05g08670 vs. TAIR 10
Match: AT1G79670.1 (Wall-associated kinase family protein ) HSP 1 Score: 72.8 bits (177), Expect = 2.1e-13 Identity = 42/107 (39.25%), Postives = 64/107 (59.81%), Query Frame = 0
BLAST of Moc05g08670 vs. TAIR 10
Match: AT1G79670.2 (Wall-associated kinase family protein ) HSP 1 Score: 72.8 bits (177), Expect = 2.1e-13 Identity = 42/107 (39.25%), Postives = 64/107 (59.81%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (OHB3-1) v2
Date Performed: 2022-08-01
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|