MS023178 (gene) Bitter gourd (TR) v1
|
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.CAGGTGAGGGAGGAGACGTATACAGCATTTGAGAACATATACCCAGTGCTTACAGAGTTCAGGAAAAACCAGCAACAGGTGAGGGAGGAGACGTATACAGCATTTGAGAACATATACCCAGTGCTTACAGAGTTCAGGAAAAACCAGCAA CAGGTGAGGGAGGAGACGTATACAGCATTTGAGAACATATACCCAGTGCTTACAGAGTTCAGGAAAAACCAGCAA QVREETYTAFENIYPVLTEFRKNQQ Homology
BLAST of MS023178 vs. NCBI nr
Match: KAG6484527.1 (hypothetical protein ZIOFF_053046 [Zingiber officinale]) HSP 1 Score: 53.1 bits (126), Expect = 3.9e-04 Identity = 24/25 (96.00%), Postives = 25/25 (100.00%), Query Frame = 0
BLAST of MS023178 vs. NCBI nr
Match: KZM93622.1 (hypothetical protein DCAR_016867 [Daucus carota subsp. sativus]) HSP 1 Score: 52.8 bits (125), Expect = 5.1e-04 Identity = 24/25 (96.00%), Postives = 25/25 (100.00%), Query Frame = 0
BLAST of MS023178 vs. NCBI nr
Match: KAG6588117.1 (TATA-box-binding protein, partial [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 52.8 bits (125), Expect = 5.1e-04 Identity = 24/25 (96.00%), Postives = 25/25 (100.00%), Query Frame = 0
BLAST of MS023178 vs. NCBI nr
Match: XP_024986276.1 (TATA-box-binding protein-like [Cynara cardunculus var. scolymus]) HSP 1 Score: 52.8 bits (125), Expect = 5.1e-04 Identity = 24/25 (96.00%), Postives = 25/25 (100.00%), Query Frame = 0
BLAST of MS023178 vs. NCBI nr
Match: XP_019162400.1 (PREDICTED: TATA-box-binding protein-like [Ipomoea nil] >XP_019162401.1 PREDICTED: TATA-box-binding protein-like [Ipomoea nil]) HSP 1 Score: 52.8 bits (125), Expect = 5.1e-04 Identity = 24/25 (96.00%), Postives = 25/25 (100.00%), Query Frame = 0
BLAST of MS023178 vs. ExPASy Swiss-Prot
Match: P48511 (TATA-box-binding protein OS=Mesembryanthemum crystallinum OX=3544 PE=2 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 6.7e-07 Identity = 24/25 (96.00%), Postives = 25/25 (100.00%), Query Frame = 0
BLAST of MS023178 vs. ExPASy Swiss-Prot
Match: P26357 (TATA-box-binding protein OS=Solanum tuberosum OX=4113 GN=TBP PE=2 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 1.5e-06 Identity = 23/25 (92.00%), Postives = 25/25 (100.00%), Query Frame = 0
BLAST of MS023178 vs. ExPASy Swiss-Prot
Match: Q42808 (TATA-box-binding protein OS=Glycine max OX=3847 GN=TBP1 PE=2 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 1.5e-06 Identity = 23/25 (92.00%), Postives = 25/25 (100.00%), Query Frame = 0
BLAST of MS023178 vs. ExPASy Swiss-Prot
Match: P93348 (TATA-box-binding protein OS=Nicotiana tabacum OX=4097 PE=2 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 1.5e-06 Identity = 23/25 (92.00%), Postives = 25/25 (100.00%), Query Frame = 0
BLAST of MS023178 vs. ExPASy Swiss-Prot
Match: Q8W0W4 (TATA-binding protein 2 OS=Oryza sativa subsp. japonica OX=39947 GN=TBP2 PE=1 SV=2) HSP 1 Score: 48.1 bits (113), Expect = 1.6e-05 Identity = 22/25 (88.00%), Postives = 24/25 (96.00%), Query Frame = 0
BLAST of MS023178 vs. ExPASy TrEMBL
Match: A0A6J1JDU6 (TATA-box-binding protein OS=Cucurbita maxima OX=3661 GN=LOC111484910 PE=3 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 2.5e-04 Identity = 24/25 (96.00%), Postives = 25/25 (100.00%), Query Frame = 0
BLAST of MS023178 vs. ExPASy TrEMBL
Match: A0A7J6GFX1 (Uncharacterized protein OS=Cannabis sativa OX=3483 GN=F8388_008980 PE=3 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 2.5e-04 Identity = 24/25 (96.00%), Postives = 25/25 (100.00%), Query Frame = 0
BLAST of MS023178 vs. ExPASy TrEMBL
Match: A0A6J1H9G6 (TATA-box-binding protein OS=Cucurbita moschata OX=3662 GN=LOC111461727 PE=3 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 2.5e-04 Identity = 24/25 (96.00%), Postives = 25/25 (100.00%), Query Frame = 0
BLAST of MS023178 vs. ExPASy TrEMBL
Match: A0A161ZZ09 (Uncharacterized protein OS=Daucus carota subsp. sativus OX=79200 GN=DCAR_016867 PE=3 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 2.5e-04 Identity = 24/25 (96.00%), Postives = 25/25 (100.00%), Query Frame = 0
BLAST of MS023178 vs. ExPASy TrEMBL
Match: A0A5A7UIK5 (TATA-box-binding protein isoform X2 OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold181G001180 PE=3 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 2.5e-04 Identity = 24/25 (96.00%), Postives = 25/25 (100.00%), Query Frame = 0
BLAST of MS023178 vs. TAIR 10
Match: AT1G55520.1 (TATA binding protein 2 ) HSP 1 Score: 45.8 bits (107), Expect = 5.8e-06 Identity = 21/25 (84.00%), Postives = 23/25 (92.00%), Query Frame = 0
BLAST of MS023178 vs. TAIR 10
Match: AT1G55520.2 (TATA binding protein 2 ) HSP 1 Score: 45.8 bits (107), Expect = 5.8e-06 Identity = 21/25 (84.00%), Postives = 23/25 (92.00%), Query Frame = 0
BLAST of MS023178 vs. TAIR 10
Match: AT3G13445.1 (TATA binding protein 1 ) HSP 1 Score: 43.1 bits (100), Expect = 3.8e-05 Identity = 19/25 (76.00%), Postives = 23/25 (92.00%), Query Frame = 0
The following BLAST results are available for this feature:
Relationships
The following mRNA feature(s) are a part of this gene:
|