MS020750 (gene) Bitter gourd (TR) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.TTCTACTTGACCCCTATTCTCCTTTCATCCGGAGCTGCCGTAACTTGGGTTCATCATGCTATACTCGCGGGGAAGGAAAAACGAGCA TTCTACTTGACCCCTATTCTCCTTTCATCCGGAGCTGCCGTAACTTGGGTTCATCATGCTATACTCGCGGGGAAGGAAAAACGAGCA TTCTACTTGACCCCTATTCTCCTTTCATCCGGAGCTGCCGTAACTTGGGTTCATCATGCTATACTCGCGGGGAAGGAAAAACGAGCA FYLTPILLSSGAAVTWVHHAILAGKEKRA Homology
BLAST of MS020750 vs. NCBI nr
Match: YP_009153952.1 (cytochrome c oxidase subunit 3 [Gossypium hirsutum] >YP_009153985.1 cytochrome c oxidase subunit 3 [Gossypium harknessii] >YP_009250110.1 cytochrome c oxidase subunit 3 [Gossypium raimondii] >YP_009388387.1 cytochrome c oxidase subunit 3 [Gossypium thurberi] >YP_009388423.1 cytochrome c oxidase subunit 3 [Gossypium davidsonii] >YP_009388459.1 cytochrome c oxidase subunit 3 [Gossypium trilobum] >YP_009498111.1 Cox3 [Bombax ceiba] >ADP20668.1 cytochrome c oxidase subunit III [Hibiscus cannabinus] >AGA54189.1 cytochrome c oxidase subunit 3 [Gossypium hirsutum] >AGA54223.1 cytochrome c oxidase subunit 3 [Gossypium harknessii] >AMT85385.1 cytochrome c oxidase subunit 3 [Gossypium thurberi] >AMT85421.1 cytochrome c oxidase subunit 3 [Gossypium davidsonii]) HSP 1 Score: 53.9 bits (128), Expect = 2.7e-04 Identity = 26/29 (89.66%), Postives = 26/29 (89.66%), Query Frame = 0
BLAST of MS020750 vs. NCBI nr
Match: YP_010035117.1 (cytochrome c oxidase subunit 3 [Euonymus alatus] >QOX10140.1 cytochrome c oxidase subunit 3 [Euonymus alatus]) HSP 1 Score: 53.9 bits (128), Expect = 2.7e-04 Identity = 26/29 (89.66%), Postives = 26/29 (89.66%), Query Frame = 0
BLAST of MS020750 vs. NCBI nr
Match: AMC32849.1 (cytochrome c oxidase subunit 3 [Oxalis dillenii]) HSP 1 Score: 53.9 bits (128), Expect = 2.7e-04 Identity = 26/29 (89.66%), Postives = 26/29 (89.66%), Query Frame = 0
BLAST of MS020750 vs. NCBI nr
Match: QHE65820.1 (cytochrome c oxidase subunit 3 [Castanospermum australe]) HSP 1 Score: 53.9 bits (128), Expect = 2.7e-04 Identity = 26/29 (89.66%), Postives = 26/29 (89.66%), Query Frame = 0
BLAST of MS020750 vs. NCBI nr
Match: AHF22721.1 (cytochrome c oxidase subunit 3, partial [Fragaria mandshurica] >AHF22722.1 cytochrome c oxidase subunit 3, partial [Fragaria vesca subsp. bracteata] >AHF22725.1 cytochrome c oxidase subunit 3, partial [Fragaria vesca subsp. vesca] >AHF22727.1 cytochrome c oxidase subunit 3, partial [Fragaria vesca subsp. bracteata] >AKE33978.1 cytochrome c oxidase subunit 3, partial [Fragaria mandshurica]) HSP 1 Score: 53.9 bits (128), Expect = 2.7e-04 Identity = 26/29 (89.66%), Postives = 26/29 (89.66%), Query Frame = 0
BLAST of MS020750 vs. ExPASy Swiss-Prot
Match: P08745 (Cytochrome c oxidase subunit 3 OS=Oenothera berteroana OX=3950 GN=COX3 PE=3 SV=2) HSP 1 Score: 53.9 bits (128), Expect = 3.5e-07 Identity = 26/29 (89.66%), Postives = 26/29 (89.66%), Query Frame = 0
BLAST of MS020750 vs. ExPASy Swiss-Prot
Match: P14853 (Cytochrome c oxidase subunit 3 OS=Glycine max OX=3847 GN=COX3 PE=2 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 3.5e-07 Identity = 26/29 (89.66%), Postives = 26/29 (89.66%), Query Frame = 0
BLAST of MS020750 vs. ExPASy Swiss-Prot
Match: Q03227 (Cytochrome c oxidase subunit 3 OS=Vicia faba OX=3906 GN=COX3 PE=3 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 3.5e-07 Identity = 26/29 (89.66%), Postives = 26/29 (89.66%), Query Frame = 0
BLAST of MS020750 vs. ExPASy Swiss-Prot
Match: Q36952 (Cytochrome c oxidase subunit 3 OS=Aegilops columnaris OX=4493 GN=COX3 PE=3 SV=1) HSP 1 Score: 51.2 bits (121), Expect = 2.3e-06 Identity = 24/26 (92.31%), Postives = 24/26 (92.31%), Query Frame = 0
BLAST of MS020750 vs. ExPASy Swiss-Prot
Match: P32808 (Cytochrome c oxidase subunit 3 OS=Helianthus annuus OX=4232 GN=COX3 PE=3 SV=1) HSP 1 Score: 51.2 bits (121), Expect = 2.3e-06 Identity = 25/29 (86.21%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MS020750 vs. ExPASy TrEMBL
Match: A0A0G2QMY0 (Cytochrome c oxidase subunit 3 OS=Gossypium hirsutum OX=3635 GN=cox3 PE=3 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 1.3e-04 Identity = 26/29 (89.66%), Postives = 26/29 (89.66%), Query Frame = 0
BLAST of MS020750 vs. ExPASy TrEMBL
Match: E9KZN7 (Cytochrome c oxidase subunit 3 OS=Vigna radiata var. radiata OX=3916 GN=cox3 PE=3 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 1.3e-04 Identity = 26/29 (89.66%), Postives = 26/29 (89.66%), Query Frame = 0
BLAST of MS020750 vs. ExPASy TrEMBL
Match: A0A6B9MI44 (Cytochrome c oxidase subunit 3 (Fragment) OS=Xanthoceras sorbifolium OX=99658 GN=cox3 PE=3 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 1.3e-04 Identity = 26/29 (89.66%), Postives = 26/29 (89.66%), Query Frame = 0
BLAST of MS020750 vs. ExPASy TrEMBL
Match: A0A6J5XXX7 (Cytochrome c oxidase subunit 3 OS=Prunus armeniaca OX=36596 GN=CURHAP_LOCUS32342 PE=3 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 1.3e-04 Identity = 26/29 (89.66%), Postives = 26/29 (89.66%), Query Frame = 0
BLAST of MS020750 vs. ExPASy TrEMBL
Match: A0A385FBE9 (Cytochrome c oxidase subunit 3 OS=Brassica juncea OX=3707 GN=cox3 PE=3 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 1.3e-04 Identity = 26/29 (89.66%), Postives = 26/29 (89.66%), Query Frame = 0
BLAST of MS020750 vs. TAIR 10
Match: AT2G07687.1 (Cytochrome c oxidase, subunit III ) HSP 1 Score: 51.2 bits (121), Expect = 1.6e-07 Identity = 25/29 (86.21%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MS020750 vs. TAIR 10
Match: ATMG00730.1 (cytochrome c oxidase subunit 3 ) HSP 1 Score: 51.2 bits (121), Expect = 1.6e-07 Identity = 25/29 (86.21%), Postives = 25/29 (86.21%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (TR) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|