MS019551 (gene) Bitter gourd (TR) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGCCTAACTATTTAACAAGTGGATTTACTGTAAATACTAGTTTGGCTCATTATTGTCAATATAATGGTCTACTTCTTCAAATTCAT ATGCCTAACTATTTAACAAGTGGATTTACTGTAAATACTAGTTTGGCTCATTATTGTCAATATAATGGTCTACTTCTTCAAATTCAT ATGCCTAACTATTTAACAAGTGGATTTACTGTAAATACTAGTTTGGCTCATTATTGTCAATATAATGGTCTACTTCTTCAAATTCAT MPNYLTSGFTVNTSLAHYCQYNGLLLQIH Homology
BLAST of MS019551 vs. NCBI nr
Match: YP_009489754.1 (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Paeonia suffruticosa] >AWH11024.1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Paeonia suffruticosa]) HSP 1 Score: 53.9 bits (128), Expect = 2.7e-04 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MS019551 vs. NCBI nr
Match: AEK34306.1 (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial [Oenothera glazioviana]) HSP 1 Score: 53.5 bits (127), Expect = 3.5e-04 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MS019551 vs. NCBI nr
Match: MBA0708715.1 (hypothetical protein [Gossypium laxum]) HSP 1 Score: 53.5 bits (127), Expect = 3.5e-04 Identity = 24/29 (82.76%), Postives = 24/29 (82.76%), Query Frame = 0
BLAST of MS019551 vs. NCBI nr
Match: WP_202958764.1 (form I ribulose bisphosphate carboxylase large subunit [Solirubrobacter sp. CPCC 204708] >MBE2321138.1 form I ribulose bisphosphate carboxylase large subunit [Solirubrobacter sp. CPCC 204708]) HSP 1 Score: 53.5 bits (127), Expect = 3.5e-04 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MS019551 vs. NCBI nr
Match: ACR07793.1 (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial [Durandea pentagyna]) HSP 1 Score: 53.5 bits (127), Expect = 3.5e-04 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MS019551 vs. ExPASy Swiss-Prot
Match: A8W3D6 (Ribulose bisphosphate carboxylase large chain OS=Cuscuta exaltata OX=476139 GN=rbcL PE=3 SV=1) HSP 1 Score: 50.4 bits (119), Expect = 3.9e-06 Identity = 22/29 (75.86%), Postives = 24/29 (82.76%), Query Frame = 0
BLAST of MS019551 vs. ExPASy Swiss-Prot
Match: P30401 (Ribulose bisphosphate carboxylase large chain OS=Cuscuta reflexa OX=4129 GN=rbcL PE=3 SV=1) HSP 1 Score: 50.4 bits (119), Expect = 3.9e-06 Identity = 22/29 (75.86%), Postives = 24/29 (82.76%), Query Frame = 0
BLAST of MS019551 vs. ExPASy Swiss-Prot
Match: O78258 (Ribulose bisphosphate carboxylase large chain (Fragment) OS=Abies firma OX=78260 GN=rbcL PE=3 SV=1) HSP 1 Score: 50.1 bits (118), Expect = 5.0e-06 Identity = 22/29 (75.86%), Postives = 24/29 (82.76%), Query Frame = 0
BLAST of MS019551 vs. ExPASy Swiss-Prot
Match: O78259 (Ribulose bisphosphate carboxylase large chain (Fragment) OS=Abies homolepis OX=78261 GN=rbcL PE=3 SV=1) HSP 1 Score: 50.1 bits (118), Expect = 5.0e-06 Identity = 22/29 (75.86%), Postives = 24/29 (82.76%), Query Frame = 0
BLAST of MS019551 vs. ExPASy Swiss-Prot
Match: O78262 (Ribulose bisphosphate carboxylase large chain (Fragment) OS=Abies sachalinensis OX=78264 GN=rbcL PE=3 SV=1) HSP 1 Score: 50.1 bits (118), Expect = 5.0e-06 Identity = 22/29 (75.86%), Postives = 24/29 (82.76%), Query Frame = 0
BLAST of MS019551 vs. ExPASy TrEMBL
Match: A0A2S1P3K4 (Ribulose bisphosphate carboxylase large chain OS=Paeonia suffruticosa OX=45171 GN=rbcL PE=3 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 1.3e-04 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MS019551 vs. ExPASy TrEMBL
Match: O78617 (Ribulose bisphosphate carboxylase large chain (Fragment) OS=Meiracyllium trinasutum OX=38189 GN=rbcL PE=3 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 1.7e-04 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MS019551 vs. ExPASy TrEMBL
Match: G0WZ32 (Ribulose bisphosphate carboxylase large chain (Fragment) OS=Oenothera glazioviana OX=482428 GN=rbcL PE=3 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 1.7e-04 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MS019551 vs. ExPASy TrEMBL
Match: C7A5X9 (Ribulose bisphosphate carboxylase large chain (Fragment) OS=Durandea pentagyna OX=289635 GN=rbcL PE=3 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 1.7e-04 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MS019551 vs. ExPASy TrEMBL
Match: A0A7J8ZAC0 (RuBisCO_large domain-containing protein OS=Gossypium laxum OX=34288 GN=Golax_023811 PE=4 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 1.7e-04 Identity = 24/29 (82.76%), Postives = 24/29 (82.76%), Query Frame = 0
BLAST of MS019551 vs. TAIR 10
Match: ATCG00490.1 (ribulose-bisphosphate carboxylases ) HSP 1 Score: 48.9 bits (115), Expect = 8.0e-07 Identity = 21/29 (72.41%), Postives = 24/29 (82.76%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (TR) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|