![](http://cucurbitgenomics.org/sites/default/files/styles/slideshow/public/carousel/101322_web.jpg?itok=EG-G51x6)
MS019530 (gene) Bitter gourd (TR) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGAATTCAGCAGGTCGAAGAAGCGGAGGAGGCCTTCTCGAAGGTCTGTACAGAGTGATTATGCGACGTAATTCTGTTTACGTAACATTCATCATCGCCGGTGCTTTCGTCGGGGAACGGGTAATG ATGAATTCAGCAGGTCGAAGAAGCGGAGGAGGCCTTCTCGAAGGTCTGTACAGAGTGATTATGCGACGTAATTCTGTTTACGTAACATTCATCATCGCCGGTGCTTTCGTCGGGGAACGGGTAATG ATGAATTCAGCAGGTCGAAGAAGCGGAGGAGGCCTTCTCGAAGGTCTGTACAGAGTGATTATGCGACGTAATTCTGTTTACGTAACATTCATCATCGCCGGTGCTTTCGTCGGGGAACGGGTAATG MNSAGRRSGGGLLEGLYRVIMRRNSVYVTFIIAGAFVGERVM Homology
BLAST of MS019530 vs. NCBI nr
Match: XP_022144609.1 (cytochrome b-c1 complex subunit 9-like [Momordica charantia]) HSP 1 Score: 80.9 bits (198), Expect = 2.9e-12 Identity = 40/42 (95.24%), Postives = 41/42 (97.62%), Query Frame = 0
BLAST of MS019530 vs. NCBI nr
Match: KAA0043883.1 (cytochrome b-c1 complex subunit 9-like [Cucumis melo var. makuwa] >TYK25254.1 cytochrome b-c1 complex subunit 9-like [Cucumis melo var. makuwa]) HSP 1 Score: 79.3 bits (194), Expect = 8.6e-12 Identity = 39/42 (92.86%), Postives = 40/42 (95.24%), Query Frame = 0
BLAST of MS019530 vs. NCBI nr
Match: XP_004149208.1 (cytochrome b-c1 complex subunit 9 [Cucumis sativus] >XP_008442838.1 PREDICTED: cytochrome b-c1 complex subunit 9 [Cucumis melo] >KGN59132.1 hypothetical protein Csa_001568 [Cucumis sativus]) HSP 1 Score: 79.3 bits (194), Expect = 8.6e-12 Identity = 39/42 (92.86%), Postives = 40/42 (95.24%), Query Frame = 0
BLAST of MS019530 vs. NCBI nr
Match: XP_022934205.1 (cytochrome b-c1 complex subunit 9-like [Cucurbita moschata] >XP_022983168.1 cytochrome b-c1 complex subunit 9-like [Cucurbita maxima] >XP_023526376.1 cytochrome b-c1 complex subunit 9-like [Cucurbita pepo subsp. pepo]) HSP 1 Score: 78.2 bits (191), Expect = 1.9e-11 Identity = 38/42 (90.48%), Postives = 40/42 (95.24%), Query Frame = 0
BLAST of MS019530 vs. NCBI nr
Match: KAG7017456.1 (hypothetical protein SDJN02_19321, partial [Cucurbita argyrosperma subsp. argyrosperma]) HSP 1 Score: 78.2 bits (191), Expect = 1.9e-11 Identity = 38/42 (90.48%), Postives = 40/42 (95.24%), Query Frame = 0
BLAST of MS019530 vs. ExPASy Swiss-Prot
Match: P46270 (Cytochrome b-c1 complex subunit 9 OS=Solanum tuberosum OX=4113 PE=1 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 4.9e-10 Identity = 29/42 (69.05%), Postives = 35/42 (83.33%), Query Frame = 0
BLAST of MS019530 vs. ExPASy Swiss-Prot
Match: Q9LXJ2 (Cytochrome b-c1 complex subunit 9, mitochondrial OS=Arabidopsis thaliana OX=3702 GN=QCR9 PE=1 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 4.6e-08 Identity = 28/42 (66.67%), Postives = 32/42 (76.19%), Query Frame = 0
BLAST of MS019530 vs. ExPASy TrEMBL
Match: A0A6J1CST4 (cytochrome b-c1 complex subunit 9-like OS=Momordica charantia OX=3673 GN=LOC111014251 PE=3 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 1.4e-12 Identity = 40/42 (95.24%), Postives = 41/42 (97.62%), Query Frame = 0
BLAST of MS019530 vs. ExPASy TrEMBL
Match: A0A5D3DNU0 (Cytochrome b-c1 complex subunit 9-like OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold352G003870 PE=3 SV=1) HSP 1 Score: 79.3 bits (194), Expect = 4.1e-12 Identity = 39/42 (92.86%), Postives = 40/42 (95.24%), Query Frame = 0
BLAST of MS019530 vs. ExPASy TrEMBL
Match: A0A0A0LEK7 (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_3G776920 PE=3 SV=1) HSP 1 Score: 79.3 bits (194), Expect = 4.1e-12 Identity = 39/42 (92.86%), Postives = 40/42 (95.24%), Query Frame = 0
BLAST of MS019530 vs. ExPASy TrEMBL
Match: A0A1S3B664 (cytochrome b-c1 complex subunit 9 OS=Cucumis melo OX=3656 GN=LOC103486605 PE=3 SV=1) HSP 1 Score: 79.3 bits (194), Expect = 4.1e-12 Identity = 39/42 (92.86%), Postives = 40/42 (95.24%), Query Frame = 0
BLAST of MS019530 vs. ExPASy TrEMBL
Match: A0A6J1J703 (cytochrome b-c1 complex subunit 9-like OS=Cucurbita maxima OX=3661 GN=LOC111481802 PE=3 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 9.2e-12 Identity = 38/42 (90.48%), Postives = 40/42 (95.24%), Query Frame = 0
BLAST of MS019530 vs. TAIR 10
Match: AT3G52730.1 (ubiquinol-cytochrome C reductase UQCRX/QCR9-like family protein ) HSP 1 Score: 57.4 bits (137), Expect = 3.2e-09 Identity = 28/42 (66.67%), Postives = 32/42 (76.19%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (TR) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|