MS007172 (gene) Bitter gourd (TR) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATTTCAACTTCTGAATCTCGATTAATTGAATCCACCGCTCCTAGTATTATTTCAAGACGTTCAGTATATAAGCCTCTTCAAACAGGACTTATTGCTATTGATTCGATGATTCCTACCGGACGTGGTCAGCGAGAATTAATTATTGGGGACAGGCAGACCGATAAAACTGCAGTAGCCACATATACGATTCTCAATCAACAAGGGGAAAATATAATATGTGTTTATGTAGCTATTGGTCAAAAAGCATCTTCTGTAGCTCAAGTAGTGACTACTTTACAGGAGGGGGGG ATTTCAACTTCTGAATCTCGATTAATTGAATCCACCGCTCCTAGTATTATTTCAAGACGTTCAGTATATAAGCCTCTTCAAACAGGACTTATTGCTATTGATTCGATGATTCCTACCGGACGTGGTCAGCGAGAATTAATTATTGGGGACAGGCAGACCGATAAAACTGCAGTAGCCACATATACGATTCTCAATCAACAAGGGGAAAATATAATATGTGTTTATGTAGCTATTGGTCAAAAAGCATCTTCTGTAGCTCAAGTAGTGACTACTTTACAGGAGGGGGGG ATTTCAACTTCTGAATCTCGATTAATTGAATCCACCGCTCCTAGTATTATTTCAAGACGTTCAGTATATAAGCCTCTTCAAACAGGACTTATTGCTATTGATTCGATGATTCCTACCGGACGTGGTCAGCGAGAATTAATTATTGGGGACAGGCAGACCGATAAAACTGCAGTAGCCACATATACGATTCTCAATCAACAAGGGGAAAATATAATATGTGTTTATGTAGCTATTGGTCAAAAAGCATCTTCTGTAGCTCAAGTAGTGACTACTTTACAGGAGGGGGGG ISTSESRLIESTAPSIISRRSVYKPLQTGLIAIDSMIPTGRGQRELIIGDRQTDKTAVATYTILNQQGENIICVYVAIGQKASSVAQVVTTLQEGG Homology
BLAST of MS007172 vs. NCBI nr
Match: YP_009662603.1 (ATP synthase CF1 alpha subunit [Amphilophium dolichoides] >YP_009662700.1 ATP synthase CF1 alpha subunit [Amphilophium carolinae] >QAY82349.1 ATP synthase CF1 alpha subunit [Amphilophium crucigerum] >QAY82346.1 ATP synthase CF1 alpha subunit [Amphilophium carolinae] >QAY82352.1 ATP synthase CF1 alpha subunit [Amphilophium dolichoides] >QCU48125.1 ATP synthase CF1 alpha subunit [Amphilophium dolichoides] >QCU48222.1 ATP synthase CF1 alpha subunit [Amphilophium carolinae]) HSP 1 Score: 163.7 bits (413), Expect = 7.9e-37 Identity = 87/96 (90.62%), Postives = 90/96 (93.75%), Query Frame = 0
BLAST of MS007172 vs. NCBI nr
Match: ATL62595.1 (ATP synthase CF1 alpha subunit [Mostuea sp. Bremer et al. 5077]) HSP 1 Score: 163.7 bits (413), Expect = 7.9e-37 Identity = 87/96 (90.62%), Postives = 90/96 (93.75%), Query Frame = 0
BLAST of MS007172 vs. NCBI nr
Match: QVX30574.1 (ATP synthase CF1 alpha subunit [Camoensia scandens]) HSP 1 Score: 163.7 bits (413), Expect = 7.9e-37 Identity = 87/96 (90.62%), Postives = 90/96 (93.75%), Query Frame = 0
BLAST of MS007172 vs. NCBI nr
Match: YP_009365902.1 (ATP synthase CF1 alpha subunit [Jasminum tortuosum] >YP_009634281.1 ATP synthase CF1 alpha subunit [Jasminum fluminense] >ARJ61432.1 ATP synthase CF1 alpha subunit [Jasminum tortuosum] >QBS49308.1 ATP synthase CF1 alpha subunit [Jasminum fluminense]) HSP 1 Score: 163.7 bits (413), Expect = 7.9e-37 Identity = 87/96 (90.62%), Postives = 90/96 (93.75%), Query Frame = 0
BLAST of MS007172 vs. NCBI nr
Match: YP_009532515.1 (ATP synthase CF1 alpha subunit [Echinacanthus attenuatus] >AYA72976.1 ATP synthase CF1 alpha subunit [Echinacanthus attenuatus]) HSP 1 Score: 163.7 bits (413), Expect = 7.9e-37 Identity = 87/96 (90.62%), Postives = 90/96 (93.75%), Query Frame = 0
BLAST of MS007172 vs. ExPASy Swiss-Prot
Match: Q06RE6 (ATP synthase subunit alpha, chloroplastic OS=Jasminum nudiflorum OX=126431 GN=atpA PE=3 SV=1) HSP 1 Score: 163.3 bits (412), Expect = 1.3e-39 Identity = 86/96 (89.58%), Postives = 90/96 (93.75%), Query Frame = 0
BLAST of MS007172 vs. ExPASy Swiss-Prot
Match: P08215 (ATP synthase subunit alpha, chloroplastic OS=Pisum sativum OX=3888 GN=atpA PE=3 SV=1) HSP 1 Score: 161.8 bits (408), Expect = 3.9e-39 Identity = 86/96 (89.58%), Postives = 90/96 (93.75%), Query Frame = 0
BLAST of MS007172 vs. ExPASy Swiss-Prot
Match: Q3BAQ7 (ATP synthase subunit alpha, chloroplastic OS=Phalaenopsis aphrodite subsp. formosana OX=308872 GN=atpA PE=3 SV=1) HSP 1 Score: 161.0 bits (406), Expect = 6.7e-39 Identity = 85/96 (88.54%), Postives = 90/96 (93.75%), Query Frame = 0
BLAST of MS007172 vs. ExPASy Swiss-Prot
Match: B1A920 (ATP synthase subunit alpha, chloroplastic OS=Carica papaya OX=3649 GN=atpA PE=3 SV=1) HSP 1 Score: 160.6 bits (405), Expect = 8.7e-39 Identity = 86/96 (89.58%), Postives = 89/96 (92.71%), Query Frame = 0
BLAST of MS007172 vs. ExPASy Swiss-Prot
Match: B1NWD5 (ATP synthase subunit alpha, chloroplastic OS=Manihot esculenta OX=3983 GN=atpA PE=3 SV=1) HSP 1 Score: 160.6 bits (405), Expect = 8.7e-39 Identity = 86/96 (89.58%), Postives = 89/96 (92.71%), Query Frame = 0
BLAST of MS007172 vs. ExPASy TrEMBL
Match: A0A411DAW5 (ATP synthase subunit alpha, chloroplastic OS=Amphilophium dolichoides OX=2358312 GN=atpA PE=3 SV=1) HSP 1 Score: 163.7 bits (413), Expect = 3.8e-37 Identity = 87/96 (90.62%), Postives = 90/96 (93.75%), Query Frame = 0
BLAST of MS007172 vs. ExPASy TrEMBL
Match: A0A411DAV6 (ATP synthase subunit alpha, chloroplastic OS=Amphilophium carolinae OX=545665 GN=atpA PE=3 SV=1) HSP 1 Score: 163.7 bits (413), Expect = 3.8e-37 Identity = 87/96 (90.62%), Postives = 90/96 (93.75%), Query Frame = 0
BLAST of MS007172 vs. ExPASy TrEMBL
Match: A0A411DAW3 (ATP synthase subunit alpha, chloroplastic OS=Amphilophium crucigerum OX=354032 GN=atpA PE=3 SV=1) HSP 1 Score: 163.7 bits (413), Expect = 3.8e-37 Identity = 87/96 (90.62%), Postives = 90/96 (93.75%), Query Frame = 0
BLAST of MS007172 vs. ExPASy TrEMBL
Match: A0A385NGR2 (ATP synthase subunit alpha, chloroplastic OS=Echinacanthus attenuatus OX=1204778 GN=atpA PE=3 SV=1) HSP 1 Score: 163.7 bits (413), Expect = 3.8e-37 Identity = 87/96 (90.62%), Postives = 90/96 (93.75%), Query Frame = 0
BLAST of MS007172 vs. ExPASy TrEMBL
Match: A0A4D5Y104 (ATP synthase subunit alpha, chloroplastic OS=Jasminum fluminense OX=84810 GN=atpA PE=3 SV=1) HSP 1 Score: 163.7 bits (413), Expect = 3.8e-37 Identity = 87/96 (90.62%), Postives = 90/96 (93.75%), Query Frame = 0
BLAST of MS007172 vs. TAIR 10
Match: ATCG00120.1 (ATP synthase subunit alpha ) HSP 1 Score: 159.1 bits (401), Expect = 1.8e-39 Identity = 85/96 (88.54%), Postives = 89/96 (92.71%), Query Frame = 0
BLAST of MS007172 vs. TAIR 10
Match: AT2G07698.1 (ATPase, F1 complex, alpha subunit protein ) HSP 1 Score: 109.4 bits (272), Expect = 1.6e-24 Identity = 56/103 (54.37%), Postives = 74/103 (71.84%), Query Frame = 0
BLAST of MS007172 vs. TAIR 10
Match: ATMG01190.1 (ATP synthase subunit 1 ) HSP 1 Score: 106.7 bits (265), Expect = 1.1e-23 Identity = 55/103 (53.40%), Postives = 73/103 (70.87%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (TR) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|