
MS002104 (gene) Bitter gourd (TR) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAATCTCAGATTAAACATGCTGTGGTGGTGAAAGTAATGGGTAGAACCGGATCTAGGGGGCAGGTAACTCAAGTTAGAGTCAAGTTTCTTGATGATCAAAATCGTTACATCATGAGGAATGTGAAGGGACCAGTGAGGGAAGGCGATATTCTGACCCTGCTGGAGTCTGAGAGAGAAGCTAGGAGATTGCGT ATGGAATCTCAGATTAAACATGCTGTGGTGGTGAAAGTAATGGGTAGAACCGGATCTAGGGGGCAGGTAACTCAAGTTAGAGTCAAGTTTCTTGATGATCAAAATCGTTACATCATGAGGAATGTGAAGGGACCAGTGAGGGAAGGCGATATTCTGACCCTGCTGGAGTCTGAGAGAGAAGCTAGGAGATTGCGT ATGGAATCTCAGATTAAACATGCTGTGGTGGTGAAAGTAATGGGTAGAACCGGATCTAGGGGGCAGGTAACTCAAGTTAGAGTCAAGTTTCTTGATGATCAAAATCGTTACATCATGAGGAATGTGAAGGGACCAGTGAGGGAAGGCGATATTCTGACCCTGCTGGAGTCTGAGAGAGAAGCTAGGAGATTGCGT MESQIKHAVVVKVMGRTGSRGQVTQVRVKFLDDQNRYIMRNVKGPVREGDILTLLESEREARRLR Homology
BLAST of MS002104 vs. NCBI nr
Match: XP_022134697.1 (40S ribosomal protein S28-1-like [Momordica charantia]) HSP 1 Score: 127.1 bits (318), Expect = 5.5e-26 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = 0
BLAST of MS002104 vs. NCBI nr
Match: XP_022922061.1 (40S ribosomal protein S28-1-like isoform X1 [Cucurbita moschata]) HSP 1 Score: 127.1 bits (318), Expect = 5.5e-26 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = 0
BLAST of MS002104 vs. NCBI nr
Match: KGN63808.2 (hypothetical protein Csa_014218 [Cucumis sativus]) HSP 1 Score: 127.1 bits (318), Expect = 5.5e-26 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = 0
BLAST of MS002104 vs. NCBI nr
Match: XP_008453374.1 (PREDICTED: 40S ribosomal protein S28-1 [Cucumis melo] >XP_008460765.1 PREDICTED: 40S ribosomal protein S28-1 [Cucumis melo] >XP_011648782.1 40S ribosomal protein S28-1 [Cucumis sativus] >XP_011653430.1 40S ribosomal protein S28-1 [Cucumis sativus] >XP_016901435.1 PREDICTED: 40S ribosomal protein S28-1 [Cucumis melo] >XP_016902595.1 PREDICTED: 40S ribosomal protein S28-1 [Cucumis melo] >XP_022152253.1 40S ribosomal protein S28-1 [Momordica charantia] >XP_022159219.1 40S ribosomal protein S28-1 [Momordica charantia] >XP_022924912.1 40S ribosomal protein S28-1 [Cucurbita moschata] >XP_022931965.1 40S ribosomal protein S28-1 [Cucurbita moschata] >XP_022932895.1 40S ribosomal protein S28-1 [Cucurbita moschata] >XP_022933469.1 40S ribosomal protein S28-1 [Cucurbita moschata] >XP_022966097.1 40S ribosomal protein S28-1 [Cucurbita maxima] >XP_022966510.1 40S ribosomal protein S28-1 [Cucurbita maxima] >XP_022967935.1 40S ribosomal protein S28-1 [Cucurbita maxima] >XP_022967936.1 40S ribosomal protein S28-1 [Cucurbita maxima] >XP_022987319.1 40S ribosomal protein S28-1 [Cucurbita maxima] >XP_023007264.1 40S ribosomal protein S28-1 [Cucurbita maxima] >XP_023516641.1 40S ribosomal protein S28-1 [Cucurbita pepo subsp. pepo] >XP_023529556.1 40S ribosomal protein S28-1 [Cucurbita pepo subsp. pepo] >XP_031744318.1 40S ribosomal protein S28-1 [Cucumis sativus] >XP_038881044.1 40S ribosomal protein S28-1 [Benincasa hispida] >XP_038881063.1 40S ribosomal protein S28-1 [Benincasa hispida] >XP_038898372.1 40S ribosomal protein S28-1 [Benincasa hispida] >KAA0056126.1 40S ribosomal protein S28-1 [Cucumis melo var. makuwa] >KAG7027624.1 40S ribosomal protein S28, partial [Cucurbita argyrosperma subsp. argyrosperma] >KAA0058054.1 40S ribosomal protein S28-1 [Cucumis melo var. makuwa] >KAA0058055.1 40S ribosomal protein S28-1 [Cucumis melo var. makuwa] >TYK02520.1 40S ribosomal protein S28-1 [Cucumis melo var. makuwa]) HSP 1 Score: 127.1 bits (318), Expect = 5.5e-26 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = 0
BLAST of MS002104 vs. NCBI nr
Match: KAG7023246.1 (40S ribosomal protein S28, partial [Cucurbita argyrosperma subsp. argyrosperma]) HSP 1 Score: 127.1 bits (318), Expect = 5.5e-26 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = 0
BLAST of MS002104 vs. ExPASy Swiss-Prot
Match: P46302 (40S ribosomal protein S28 OS=Zea mays OX=4577 GN=RPS28 PE=3 SV=1) HSP 1 Score: 114.0 bits (284), Expect = 6.4e-25 Identity = 59/65 (90.77%), Postives = 62/65 (95.38%), Query Frame = 0
BLAST of MS002104 vs. ExPASy Swiss-Prot
Match: Q9SR73 (40S ribosomal protein S28-1 OS=Arabidopsis thaliana OX=3702 GN=RPS28A PE=3 SV=1) HSP 1 Score: 113.2 bits (282), Expect = 1.1e-24 Identity = 60/65 (92.31%), Postives = 62/65 (95.38%), Query Frame = 0
BLAST of MS002104 vs. ExPASy Swiss-Prot
Match: P34789 (40S ribosomal protein S28-2 OS=Arabidopsis thaliana OX=3702 GN=RPS28C PE=3 SV=1) HSP 1 Score: 111.3 bits (277), Expect = 4.1e-24 Identity = 58/65 (89.23%), Postives = 62/65 (95.38%), Query Frame = 0
BLAST of MS002104 vs. ExPASy Swiss-Prot
Match: Q6PBK3 (40S ribosomal protein S28 OS=Danio rerio OX=7955 GN=rps28 PE=3 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 8.0e-20 Identity = 49/61 (80.33%), Postives = 55/61 (90.16%), Query Frame = 0
BLAST of MS002104 vs. ExPASy Swiss-Prot
Match: Q90YP3 (40S ribosomal protein S28 OS=Ictalurus punctatus OX=7998 GN=rps28 PE=3 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 8.0e-20 Identity = 49/61 (80.33%), Postives = 55/61 (90.16%), Query Frame = 0
BLAST of MS002104 vs. ExPASy TrEMBL
Match: A0A6J1HTG7 (40S ribosomal protein S28-1 OS=Cucurbita maxima OX=3661 GN=LOC111467300 PE=3 SV=1) HSP 1 Score: 127.1 bits (318), Expect = 2.7e-26 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = 0
BLAST of MS002104 vs. ExPASy TrEMBL
Match: A0A0A0LPR2 (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_1G021920 PE=3 SV=1) HSP 1 Score: 127.1 bits (318), Expect = 2.7e-26 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = 0
BLAST of MS002104 vs. ExPASy TrEMBL
Match: A0A1S3CD61 (40S ribosomal protein S28-1 OS=Cucumis melo OX=3656 GN=LOC103499526 PE=3 SV=1) HSP 1 Score: 127.1 bits (318), Expect = 2.7e-26 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = 0
BLAST of MS002104 vs. ExPASy TrEMBL
Match: A0A6J1E1S7 (40S ribosomal protein S28-1 OS=Momordica charantia OX=3673 GN=LOC111025637 PE=3 SV=1) HSP 1 Score: 127.1 bits (318), Expect = 2.7e-26 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = 0
BLAST of MS002104 vs. ExPASy TrEMBL
Match: A0A6J1EZU9 (40S ribosomal protein S28-1 OS=Cucurbita moschata OX=3662 GN=LOC111440874 PE=3 SV=1) HSP 1 Score: 127.1 bits (318), Expect = 2.7e-26 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = 0
BLAST of MS002104 vs. TAIR 10
Match: AT3G10090.1 (Nucleic acid-binding, OB-fold-like protein ) HSP 1 Score: 113.2 bits (282), Expect = 7.7e-26 Identity = 60/65 (92.31%), Postives = 62/65 (95.38%), Query Frame = 0
BLAST of MS002104 vs. TAIR 10
Match: AT5G03850.1 (Nucleic acid-binding, OB-fold-like protein ) HSP 1 Score: 113.2 bits (282), Expect = 7.7e-26 Identity = 60/65 (92.31%), Postives = 62/65 (95.38%), Query Frame = 0
BLAST of MS002104 vs. TAIR 10
Match: AT5G64140.1 (ribosomal protein S28 ) HSP 1 Score: 111.3 bits (277), Expect = 2.9e-25 Identity = 58/65 (89.23%), Postives = 62/65 (95.38%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (TR) v1
Date Performed: 2021-10-25 Position : 0 Zoom : x 1
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|