![](http://cucurbitgenomics.org/sites/default/files/styles/slideshow/public/carousel/101322_web.jpg?itok=EG-G51x6)
MELO.jh102151.1 (gene) Melon (Harukei-3) v1.41
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGCCTTCTATCTCATCTAGTGGATCTTATAAGGCACGTGTTGATGTTCATGATAGATTTAAACAAAATAACAAAACATGTCTAGATGATGTTAAAACAGAGGTGGCTCGTTATCTGGATGAGGCTCGTATAGAAGATGAATATTTAGATTTGCTAAATTGGTGGAAGATGAATTCCTCTCGATTTAAGATCATTAGCCAAGTAGCCAGGGACATCTACGATATTCCTATATCAACTGTGCCTTCTGAGTTCGCCTTTAGCACTGAAGGACGGGTGTTAGATTCTTTTCGAAGTTCTTTAACTCCTCAAACTGCAGAGGCACTCATTTGTGCTCAAAATTAG ATGCCTTCTATCTCATCTAGTGGATCTTATAAGGCACGTGTTGATGTTCATGATAGATTTAAACAAAATAACAAAACATGTCTAGATGATGTTAAAACAGAGGTGGCTCGTTATCTGGATGAGGCTCGTATAGAAGATGAATATTTAGATTTGCTAAATTGGTGGAAGATGAATTCCTCTCGATTTAAGATCATTAGCCAAGTAGCCAGGGACATCTACGATATTCCTATATCAACTGTGCCTTCTGAGTTCGCCTTTAGCACTGAAGGACGGGTGTTAGATTCTTTTCGAAGTTCTTTAACTCCTCAAACTGCAGAGGCACTCATTTGTGCTCAAAATTAG ATGCCTTCTATCTCATCTAGTGGATCTTATAAGGCACGTGTTGATGTTCATGATAGATTTAAACAAAATAACAAAACATGTCTAGATGATGTTAAAACAGAGGTGGCTCGTTATCTGGATGAGGCTCGTATAGAAGATGAATATTTAGATTTGCTAAATTGGTGGAAGATGAATTCCTCTCGATTTAAGATCATTAGCCAAGTAGCCAGGGACATCTACGATATTCCTATATCAACTGTGCCTTCTGAGTTCGCCTTTAGCACTGAAGGACGGGTGTTAGATTCTTTTCGAAGTTCTTTAACTCCTCAAACTGCAGAGGCACTCATTTGTGCTCAAAATTAG MPSISSSGSYKARVDVHDRFKQNNKTCLDDVKTEVARYLDEARIEDEYLDLLNWWKMNSSRFKIISQVARDIYDIPISTVPSEFAFSTEGRVLDSFRSSLTPQTAEALICAQN Homology
BLAST of MELO.jh102151.1 vs. NCBI nr
Match: KAA0025878.1 (zinc finger BED domain-containing protein RICESLEEPER 4-like [Cucumis melo var. makuwa]) HSP 1 Score: 229 bits (585), Expect = 6.68e-76 Identity = 113/113 (100.00%), Postives = 113/113 (100.00%), Query Frame = 0
BLAST of MELO.jh102151.1 vs. NCBI nr
Match: TYK04294.1 (zinc finger BED domain-containing protein RICESLEEPER 4-like [Cucumis melo var. makuwa]) HSP 1 Score: 203 bits (517), Expect = 3.23e-64 Identity = 101/113 (89.38%), Postives = 105/113 (92.92%), Query Frame = 0
BLAST of MELO.jh102151.1 vs. NCBI nr
Match: KAA0039652.1 (zinc finger BED domain-containing protein RICESLEEPER 2-like isoform X3 [Cucumis melo var. makuwa] >TYJ95536.1 zinc finger BED domain-containing protein RICESLEEPER 2-like isoform X3 [Cucumis melo var. makuwa]) HSP 1 Score: 201 bits (512), Expect = 5.46e-64 Identity = 99/113 (87.61%), Postives = 104/113 (92.04%), Query Frame = 0
BLAST of MELO.jh102151.1 vs. NCBI nr
Match: KAA0067919.1 (zinc finger BED domain-containing protein RICESLEEPER 4-like [Cucumis melo var. makuwa]) HSP 1 Score: 200 bits (508), Expect = 2.79e-63 Identity = 100/113 (88.50%), Postives = 104/113 (92.04%), Query Frame = 0
BLAST of MELO.jh102151.1 vs. NCBI nr
Match: XP_008464607.1 (PREDICTED: zinc finger BED domain-containing protein RICESLEEPER 4-like [Cucumis melo]) HSP 1 Score: 200 bits (508), Expect = 2.97e-63 Identity = 100/113 (88.50%), Postives = 104/113 (92.04%), Query Frame = 0
BLAST of MELO.jh102151.1 vs. ExPASy Swiss-Prot
Match: Q9M2N5 (Zinc finger BED domain-containing protein DAYSLEEPER OS=Arabidopsis thaliana OX=3702 GN=HAT PE=1 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 6.7e-14 Identity = 35/89 (39.33%), Postives = 59/89 (66.29%), Query Frame = 0
BLAST of MELO.jh102151.1 vs. ExPASy Swiss-Prot
Match: Q6AVI0 (Zinc finger BED domain-containing protein RICESLEEPER 2 OS=Oryza sativa subsp. japonica OX=39947 GN=Os03g0733400 PE=2 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 6.7e-14 Identity = 41/88 (46.59%), Postives = 62/88 (70.45%), Query Frame = 0
BLAST of MELO.jh102151.1 vs. ExPASy Swiss-Prot
Match: B9FJG3 (Zinc finger BED domain-containing protein RICESLEEPER 1 OS=Oryza sativa subsp. japonica OX=39947 GN=Os05g0239150 PE=3 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 7.4e-13 Identity = 39/88 (44.32%), Postives = 61/88 (69.32%), Query Frame = 0
BLAST of MELO.jh102151.1 vs. ExPASy Swiss-Prot
Match: Q75HY5 (Zinc finger BED domain-containing protein RICESLEEPER 3 OS=Oryza sativa subsp. japonica OX=39947 GN=Os05g0583200 PE=2 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 6.3e-12 Identity = 38/88 (43.18%), Postives = 60/88 (68.18%), Query Frame = 0
BLAST of MELO.jh102151.1 vs. ExPASy Swiss-Prot
Match: P08770 (Putative AC transposase OS=Zea mays OX=4577 PE=2 SV=2) HSP 1 Score: 69.7 bits (169), Expect = 2.4e-11 Identity = 32/81 (39.51%), Postives = 53/81 (65.43%), Query Frame = 0
BLAST of MELO.jh102151.1 vs. ExPASy TrEMBL
Match: A0A5A7SI78 (Zinc finger BED domain-containing protein RICESLEEPER 4-like OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold34G001590 PE=4 SV=1) HSP 1 Score: 229 bits (585), Expect = 3.23e-76 Identity = 113/113 (100.00%), Postives = 113/113 (100.00%), Query Frame = 0
BLAST of MELO.jh102151.1 vs. ExPASy TrEMBL
Match: A0A5D3BZ93 (Zinc finger BED domain-containing protein RICESLEEPER 4-like OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold527G00220 PE=4 SV=1) HSP 1 Score: 203 bits (517), Expect = 1.56e-64 Identity = 101/113 (89.38%), Postives = 105/113 (92.92%), Query Frame = 0
BLAST of MELO.jh102151.1 vs. ExPASy TrEMBL
Match: A0A5D3B9J0 (Zinc finger BED domain-containing protein RICESLEEPER 2-like isoform X3 OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold767G00270 PE=4 SV=1) HSP 1 Score: 201 bits (512), Expect = 2.65e-64 Identity = 99/113 (87.61%), Postives = 104/113 (92.04%), Query Frame = 0
BLAST of MELO.jh102151.1 vs. ExPASy TrEMBL
Match: A0A5A7VRX9 (Zinc finger BED domain-containing protein RICESLEEPER 4-like OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold138G00860 PE=4 SV=1) HSP 1 Score: 200 bits (508), Expect = 1.35e-63 Identity = 100/113 (88.50%), Postives = 104/113 (92.04%), Query Frame = 0
BLAST of MELO.jh102151.1 vs. ExPASy TrEMBL
Match: A0A1S3CNE8 (zinc finger BED domain-containing protein RICESLEEPER 4-like OS=Cucumis melo OX=3656 GN=LOC103502449 PE=4 SV=1) HSP 1 Score: 200 bits (508), Expect = 1.44e-63 Identity = 100/113 (88.50%), Postives = 104/113 (92.04%), Query Frame = 0
BLAST of MELO.jh102151.1 vs. TAIR 10
Match: AT3G42170.1 (BED zinc finger ;hAT family dimerisation domain ) HSP 1 Score: 78.2 bits (191), Expect = 4.8e-15 Identity = 35/89 (39.33%), Postives = 59/89 (66.29%), Query Frame = 0
BLAST of MELO.jh102151.1 vs. TAIR 10
Match: AT1G18560.1 (BED zinc finger ;hAT family dimerisation domain ) HSP 1 Score: 50.1 bits (118), Expect = 1.4e-06 Identity = 24/85 (28.24%), Postives = 48/85 (56.47%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Melon (Harukei-3) v1.41
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|