MC11g1376 (gene) Bitter gourd (Dali-11) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptideutr3 Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAAGGACAAGAAGATGTATTTGGAACTGCAGACAGTTTGGGTGAGGGAAAGGTGGAGGAGCATCCTGTTGAAATCAAGGCCTTGTTTTTCGCTCGGGCTCGAGATCTCACGGGCATGAACGACCTCGTATTAGAGGTCCCATCAGGCAGTACTGCCAAGGATTGTTTGAACAAGATTGTAGGCAGATTTCCAAGGCTGGAAGAGATAGTTGGATGTGTGGTTCTGGCTCTGAACGAGGATTATACAACTGAGTCAACAATTGTTAAAGACAAAGACGAGTTGGCAATTATCCCTCCCATAAGTGGTGGCTAATCTTTCTTTCTGTTGCCATTCAAAACAGATTTTTCTTCTGCTGCTTTTTCAGCTGTGGGACCATTCAGCTTCTGACTCAACTGTGTACAAAATTACTTGTATCATATGAAAGTTATTGTACAATTTGTTTTCATCTTCAAACTTTCTTTCAACCATGTAGAAAAATTACTACTTGTATCATATGAATGTTTTTGGGACCATTATAAAATATCTACTTTGTTAGGATTGCGAAA ATGGAAGGACAAGAAGATGTATTTGGAACTGCAGACAGTTTGGGTGAGGGAAAGGTGGAGGAGCATCCTGTTGAAATCAAGGCCTTGTTTTTCGCTCGGGCTCGAGATCTCACGGGCATGAACGACCTCGTATTAGAGGTCCCATCAGGCAGTACTGCCAAGGATTGTTTGAACAAGATTGTAGGCAGATTTCCAAGGCTGGAAGAGATAGTTGGATGTGTGGTTCTGGCTCTGAACGAGGATTATACAACTGAGTCAACAATTGTTAAAGACAAAGACGAGTTGGCAATTATCCCTCCCATAAGTGGTGGCTAATCTTTCTTTCTGTTGCCATTCAAAACAGATTTTTCTTCTGCTGCTTTTTCAGCTGTGGGACCATTCAGCTTCTGACTCAACTGTGTACAAAATTACTTGTATCATATGAAAGTTATTGTACAATTTGTTTTCATCTTCAAACTTTCTTTCAACCATGTAGAAAAATTACTACTTGTATCATATGAATGTTTTTGGGACCATTATAAAATATCTACTTTGTTAGGATTGCGAAA ATGGAAGGACAAGAAGATGTATTTGGAACTGCAGACAGTTTGGGTGAGGGAAAGGTGGAGGAGCATCCTGTTGAAATCAAGGCCTTGTTTTTCGCTCGGGCTCGAGATCTCACGGGCATGAACGACCTCGTATTAGAGGTCCCATCAGGCAGTACTGCCAAGGATTGTTTGAACAAGATTGTAGGCAGATTTCCAAGGCTGGAAGAGATAGTTGGATGTGTGGTTCTGGCTCTGAACGAGGATTATACAACTGAGTCAACAATTGTTAAAGACAAAGACGAGTTGGCAATTATCCCTCCCATAAGTGGTGGCTAA MEGQEDVFGTADSLGEGKVEEHPVEIKALFFARARDLTGMNDLVLEVPSGSTAKDCLNKIVGRFPRLEEIVGCVVLALNEDYTTESTIVKDKDELAIIPPISGG Homology
BLAST of MC11g1376 vs. ExPASy Swiss-Prot
Match: Q9S7A3 (Molybdopterin synthase sulfur carrier subunit OS=Arabidopsis thaliana OX=3702 GN=At4g10100 PE=3 SV=1) HSP 1 Score: 117.5 bits (293), Expect = 9.2e-26 Identity = 55/81 (67.90%), Postives = 69/81 (85.19%), Query Frame = 0
BLAST of MC11g1376 vs. ExPASy Swiss-Prot
Match: B6SXF8 (Molybdopterin synthase sulfur carrier subunit OS=Zea mays OX=4577 GN=VP15 PE=2 SV=1) HSP 1 Score: 110.2 bits (274), Expect = 1.5e-23 Identity = 51/79 (64.56%), Postives = 63/79 (79.75%), Query Frame = 0
BLAST of MC11g1376 vs. ExPASy Swiss-Prot
Match: A2X635 (Molybdopterin synthase sulfur carrier subunit OS=Oryza sativa subsp. indica OX=39946 GN=OsI_07667 PE=3 SV=1) HSP 1 Score: 108.6 bits (270), Expect = 4.3e-23 Identity = 52/81 (64.20%), Postives = 63/81 (77.78%), Query Frame = 0
BLAST of MC11g1376 vs. ExPASy Swiss-Prot
Match: Q6YVX4 (Molybdopterin synthase sulfur carrier subunit OS=Oryza sativa subsp. japonica OX=39947 GN=Os02g0558300 PE=3 SV=1) HSP 1 Score: 108.6 bits (270), Expect = 4.3e-23 Identity = 52/81 (64.20%), Postives = 63/81 (77.78%), Query Frame = 0
BLAST of MC11g1376 vs. ExPASy Swiss-Prot
Match: A8JJB2 (Molybdopterin synthase sulfur carrier subunit OS=Chlamydomonas reinhardtii OX=3055 GN=CHLREDRAFT_109356 PE=3 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 2.6e-12 Identity = 32/83 (38.55%), Postives = 55/83 (66.27%), Query Frame = 0
BLAST of MC11g1376 vs. NCBI nr
Match: XP_022141756.1 (molybdopterin synthase sulfur carrier subunit [Momordica charantia] >XP_022141757.1 molybdopterin synthase sulfur carrier subunit [Momordica charantia] >XP_022141758.1 molybdopterin synthase sulfur carrier subunit [Momordica charantia] >XP_022141759.1 molybdopterin synthase sulfur carrier subunit [Momordica charantia]) HSP 1 Score: 208 bits (530), Expect = 8.47e-68 Identity = 104/104 (100.00%), Postives = 104/104 (100.00%), Query Frame = 0
BLAST of MC11g1376 vs. NCBI nr
Match: XP_023522482.1 (molybdopterin synthase sulfur carrier subunit [Cucurbita pepo subsp. pepo]) HSP 1 Score: 177 bits (450), Expect = 1.27e-55 Identity = 91/104 (87.50%), Postives = 99/104 (95.19%), Query Frame = 0
BLAST of MC11g1376 vs. NCBI nr
Match: XP_022932461.1 (molybdopterin synthase sulfur carrier subunit [Cucurbita moschata] >KAG6607527.1 Molybdopterin synthase sulfur carrier subunit, partial [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 171 bits (434), Expect = 3.51e-53 Identity = 88/104 (84.62%), Postives = 97/104 (93.27%), Query Frame = 0
BLAST of MC11g1376 vs. NCBI nr
Match: KAG7037169.1 (Molybdopterin synthase sulfur carrier subunit, partial [Cucurbita argyrosperma subsp. argyrosperma]) HSP 1 Score: 171 bits (434), Expect = 1.28e-52 Identity = 88/104 (84.62%), Postives = 97/104 (93.27%), Query Frame = 0
BLAST of MC11g1376 vs. NCBI nr
Match: XP_022973403.1 (molybdopterin synthase sulfur carrier subunit [Cucurbita maxima]) HSP 1 Score: 169 bits (429), Expect = 2.03e-52 Identity = 88/104 (84.62%), Postives = 97/104 (93.27%), Query Frame = 0
BLAST of MC11g1376 vs. ExPASy TrEMBL
Match: A0A6J1CKR6 (Molybdopterin synthase sulfur carrier subunit OS=Momordica charantia OX=3673 GN=LOC111012042 PE=3 SV=1) HSP 1 Score: 208 bits (530), Expect = 4.10e-68 Identity = 104/104 (100.00%), Postives = 104/104 (100.00%), Query Frame = 0
BLAST of MC11g1376 vs. ExPASy TrEMBL
Match: A0A6J1EWF4 (Molybdopterin synthase sulfur carrier subunit OS=Cucurbita moschata OX=3662 GN=LOC111438870 PE=3 SV=1) HSP 1 Score: 171 bits (434), Expect = 1.70e-53 Identity = 88/104 (84.62%), Postives = 97/104 (93.27%), Query Frame = 0
BLAST of MC11g1376 vs. ExPASy TrEMBL
Match: A0A6J1ICY6 (Molybdopterin synthase sulfur carrier subunit OS=Cucurbita maxima OX=3661 GN=LOC111471951 PE=3 SV=1) HSP 1 Score: 169 bits (429), Expect = 9.83e-53 Identity = 88/104 (84.62%), Postives = 97/104 (93.27%), Query Frame = 0
BLAST of MC11g1376 vs. ExPASy TrEMBL
Match: A0A1S4E2J1 (Molybdopterin synthase sulfur carrier subunit OS=Cucumis melo OX=3656 GN=LOC103498674 PE=3 SV=1) HSP 1 Score: 161 bits (408), Expect = 1.77e-49 Identity = 81/104 (77.88%), Postives = 92/104 (88.46%), Query Frame = 0
BLAST of MC11g1376 vs. ExPASy TrEMBL
Match: A0A0A0KSV6 (Molybdopterin synthase sulfur carrier subunit OS=Cucumis sativus OX=3659 GN=Csa_5G649330 PE=3 SV=1) HSP 1 Score: 156 bits (395), Expect = 1.55e-47 Identity = 79/104 (75.96%), Postives = 91/104 (87.50%), Query Frame = 0
BLAST of MC11g1376 vs. TAIR 10
Match: AT4G10100.1 (co-factor for nitrate, reductase and xanthine dehydrogenase 7 ) HSP 1 Score: 117.5 bits (293), Expect = 6.5e-27 Identity = 55/81 (67.90%), Postives = 69/81 (85.19%), Query Frame = 0
BLAST of MC11g1376 vs. TAIR 10
Match: AT4G10100.2 (co-factor for nitrate, reductase and xanthine dehydrogenase 7 ) HSP 1 Score: 117.5 bits (293), Expect = 6.5e-27 Identity = 55/81 (67.90%), Postives = 69/81 (85.19%), Query Frame = 0
BLAST of MC11g1376 vs. TAIR 10
Match: AT4G10100.3 (co-factor for nitrate, reductase and xanthine dehydrogenase 7 ) HSP 1 Score: 117.5 bits (293), Expect = 6.5e-27 Identity = 55/81 (67.90%), Postives = 69/81 (85.19%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (Dali-11) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|