MC08g1568 (gene) Bitter gourd (Dali-11) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.TCCACCTTAACGACAGAAAAAAGGATTGATCAAATTCTATTGAGTCTGACTCATAGTGATCATTTATCAAAGAATGACTCTGGT TCCACCTTAACGACAGAAAAAAGGATTGATCAAATTCTATTGAGTCTGACTCATAGTGATCATTTATCAAAGAATGACTCTGGT TCCACCTTAACGACAGAAAAAAGGATTGATCAAATTCTATTGAGTCTGACTCATAGTGATCATTTATCAAAGAATGACTCTGGT STLTTEKRIDQILLSLTHSDHLSKNDSG Homology
BLAST of MC08g1568 vs. ExPASy Swiss-Prot
Match: A6MM80 (Protein Ycf2 OS=Buxus microphylla OX=153571 GN=ycf2-A PE=3 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 3.0e-08 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 0
BLAST of MC08g1568 vs. ExPASy Swiss-Prot
Match: Q2QD30 (Protein Ycf2 OS=Cucumis sativus OX=3659 GN=ycf2-A PE=3 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 3.0e-08 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 0
BLAST of MC08g1568 vs. ExPASy Swiss-Prot
Match: Q0G9Q1 (Protein Ycf2 OS=Daucus carota OX=4039 GN=ycf2-A PE=3 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 3.0e-08 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 0
BLAST of MC08g1568 vs. ExPASy Swiss-Prot
Match: A6MMQ1 (Protein Ycf2 OS=Dioscorea elephantipes OX=145284 GN=ycf2-A PE=3 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 3.0e-08 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 0
BLAST of MC08g1568 vs. ExPASy Swiss-Prot
Match: Q06GT4 (Protein Ycf2 OS=Drimys granadensis OX=224735 GN=ycf2-A PE=3 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 3.0e-08 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 0
BLAST of MC08g1568 vs. NCBI nr
Match: VVW84357.1 (unnamed protein product, partial [Nymphaea colorata]) HSP 1 Score: 57.0 bits (136), Expect = 9.60e-10 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 0
BLAST of MC08g1568 vs. NCBI nr
Match: VVW90598.1 (unnamed protein product, partial [Nymphaea colorata]) HSP 1 Score: 57.0 bits (136), Expect = 1.10e-09 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 0
BLAST of MC08g1568 vs. NCBI nr
Match: MBA0659398.1 (hypothetical protein [Gossypium klotzschianum]) HSP 1 Score: 57.0 bits (136), Expect = 3.65e-09 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 0
BLAST of MC08g1568 vs. NCBI nr
Match: VVW93099.1 (unnamed protein product, partial [Nymphaea colorata]) HSP 1 Score: 57.0 bits (136), Expect = 4.17e-09 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 0
BLAST of MC08g1568 vs. NCBI nr
Match: VVW88503.1 (unnamed protein product, partial [Nymphaea colorata]) HSP 1 Score: 57.0 bits (136), Expect = 6.46e-09 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 0
BLAST of MC08g1568 vs. ExPASy TrEMBL
Match: A0A5K1HBC3 (Uncharacterized protein (Fragment) OS=Nymphaea colorata OX=210225 GN=NYM_LOCUS28964 PE=4 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 4.65e-10 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 0
BLAST of MC08g1568 vs. ExPASy TrEMBL
Match: A0A5K1HT09 (Uncharacterized protein (Fragment) OS=Nymphaea colorata OX=210225 GN=NYM_LOCUS30716 PE=4 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 5.32e-10 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 0
BLAST of MC08g1568 vs. ExPASy TrEMBL
Match: A0A7J8V9C7 (Uncharacterized protein OS=Gossypium klotzschianum OX=34286 GN=Goklo_011538 PE=4 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 1.77e-09 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 0
BLAST of MC08g1568 vs. ExPASy TrEMBL
Match: A0A5K1HUL0 (Uncharacterized protein (Fragment) OS=Nymphaea colorata OX=210225 GN=NYM_LOCUS31384 PE=4 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 2.02e-09 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 0
BLAST of MC08g1568 vs. ExPASy TrEMBL
Match: A0A5K1HKN4 (Uncharacterized protein (Fragment) OS=Nymphaea colorata OX=210225 GN=NYM_LOCUS30103 PE=4 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 3.13e-09 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 0
BLAST of MC08g1568 vs. TAIR 10
Match: ATCG00860.1 (Chloroplast Ycf2;ATPase, AAA type, core ) HSP 1 Score: 53.1 bits (126), Expect = 4.1e-08 Identity = 26/28 (92.86%), Postives = 26/28 (92.86%), Query Frame = 0
BLAST of MC08g1568 vs. TAIR 10
Match: ATCG01280.1 (Chloroplast Ycf2;ATPase, AAA type, core ) HSP 1 Score: 53.1 bits (126), Expect = 4.1e-08 Identity = 26/28 (92.86%), Postives = 26/28 (92.86%), Query Frame = 0
The following BLAST results are available for this feature:
Relationships
The following mRNA feature(s) are a part of this gene:
|