MC08g1357 (gene) Bitter gourd (Dali-11) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.GGACATTATGCACTTGTTACACAACAACCCTTTAGAGGAAGGGCCAAGCAAGGTGAACAACGGGTGGGAGAAATGAAGATC GGACATTATGCACTTGTTACACAACAACCCTTTAGAGGAAGGGCCAAGCAAGGTGAACAACGGGTGGGAGAAATGAAGATC GGACATTATGCACTTGTTACACAACAACCCTTTAGAGGAAGGGCCAAGCAAGGTGAACAACGGGTGGGAGAAATGAAGATC GHYALVTQQPFRGRAKQGEQRVGEMKI Homology
BLAST of MC08g1357 vs. ExPASy Swiss-Prot
Match: A9LYH7 (DNA-directed RNA polymerase subunit beta OS=Acorus americanus OX=263995 GN=rpoB PE=3 SV=1) HSP 1 Score: 51.2 bits (121), Expect = 2.1e-06 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = 0
BLAST of MC08g1357 vs. ExPASy Swiss-Prot
Match: Q3V542 (DNA-directed RNA polymerase subunit beta OS=Acorus calamus OX=4465 GN=rpoB PE=3 SV=2) HSP 1 Score: 51.2 bits (121), Expect = 2.1e-06 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = 0
BLAST of MC08g1357 vs. ExPASy Swiss-Prot
Match: Q5QA72 (DNA-directed RNA polymerase subunit beta OS=Acorus gramineus OX=55184 GN=rpoB PE=3 SV=1) HSP 1 Score: 51.2 bits (121), Expect = 2.1e-06 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = 0
BLAST of MC08g1357 vs. ExPASy Swiss-Prot
Match: P60282 (DNA-directed RNA polymerase subunit beta OS=Amborella trichopoda OX=13333 GN=rpoB PE=3 SV=2) HSP 1 Score: 51.2 bits (121), Expect = 2.1e-06 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = 0
BLAST of MC08g1357 vs. ExPASy Swiss-Prot
Match: Q8S8X9 (DNA-directed RNA polymerase subunit beta OS=Atropa belladonna OX=33113 GN=rpoB PE=3 SV=1) HSP 1 Score: 51.2 bits (121), Expect = 2.1e-06 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = 0
BLAST of MC08g1357 vs. NCBI nr
Match: BBN70082.1 (hypothetical protein Prudu_1405S000400 [Prunus dulcis]) HSP 1 Score: 50.8 bits (120), Expect = 1.15e-06 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = 0
BLAST of MC08g1357 vs. NCBI nr
Match: NLZ73073.1 (DNA-directed RNA polymerase subunit beta [Bacteroidales bacterium]) HSP 1 Score: 50.8 bits (120), Expect = 1.42e-06 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = 0
BLAST of MC08g1357 vs. NCBI nr
Match: THF98475.1 (hypothetical protein TEA_005970 [Camellia sinensis var. sinensis]) HSP 1 Score: 50.8 bits (120), Expect = 2.04e-06 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = 0
BLAST of MC08g1357 vs. NCBI nr
Match: RYR71192.1 (hypothetical protein Ahy_A02g005489 [Arachis hypogaea]) HSP 1 Score: 50.8 bits (120), Expect = 2.45e-06 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = 0
BLAST of MC08g1357 vs. NCBI nr
Match: THV56509.1 (DNA-directed RNA polymerase subunit beta, partial [Muricauda alvinocaridis]) HSP 1 Score: 50.8 bits (120), Expect = 2.65e-06 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = 0
BLAST of MC08g1357 vs. ExPASy TrEMBL
Match: A0A5H2XTM0 (DNA-directed RNA polymerase OS=Prunus dulcis OX=3755 GN=Prudu_1405S000400 PE=3 SV=1) HSP 1 Score: 50.8 bits (120), Expect = 5.58e-07 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = 0
BLAST of MC08g1357 vs. ExPASy TrEMBL
Match: A0A7X8ZSZ9 (DNA-directed RNA polymerase subunit beta OS=Bacteroidales bacterium OX=2030927 GN=GX905_04560 PE=4 SV=1) HSP 1 Score: 50.8 bits (120), Expect = 6.85e-07 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = 0
BLAST of MC08g1357 vs. ExPASy TrEMBL
Match: A0A3Q7J8Y1 (DNA-directed RNA polymerase OS=Solanum lycopersicum OX=4081 PE=3 SV=1) HSP 1 Score: 50.8 bits (120), Expect = 7.10e-07 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = 0
BLAST of MC08g1357 vs. ExPASy TrEMBL
Match: A0A4S4DAD9 (DNA-directed RNA polymerase OS=Camellia sinensis var. sinensis OX=542762 GN=TEA_005970 PE=3 SV=1) HSP 1 Score: 50.8 bits (120), Expect = 9.86e-07 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = 0
BLAST of MC08g1357 vs. ExPASy TrEMBL
Match: A0A445E6V2 (DNA-directed RNA polymerase OS=Arachis hypogaea OX=3818 GN=Ahy_A02g005489 PE=3 SV=1) HSP 1 Score: 50.8 bits (120), Expect = 1.19e-06 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = 0
BLAST of MC08g1357 vs. TAIR 10
Match: ATCG00190.1 (RNA polymerase subunit beta ) HSP 1 Score: 50.1 bits (118), Expect = 3.3e-07 Identity = 22/27 (81.48%), Postives = 25/27 (92.59%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (Dali-11) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|