
MC07g0810 (gene) Bitter gourd (Dali-11) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.AATGCACTTGGTGTCGTAGCTAATCAAGTAGCTTTTGAAGCATGTGTACAAGCTCATAACAAGGGACGTCATCTTGCTCTTGAGGGTAATGAAATTATTTGTGAGGCT AATGCACTTGGTGTCGTAGCTAATCAAGTAGCTTTTGAAGCATGTGTACAAGCTCATAACAAGGGACGTCATCTTGCTCTTGAGGGTAATGAAATTATTTGTGAGGCT AATGCACTTGGTGTCGTAGCTAATCAAGTAGCTTTTGAAGCATGTGTACAAGCTCATAACAAGGGACGTCATCTTGCTCTTGAGGGTAATGAAATTATTTGTGAGGCT NALGVVANQVAFEACVQAHNKGRHLALEGNEIICEA Homology
BLAST of MC07g0810 vs. ExPASy Swiss-Prot
Match: A4QKB3 (Ribulose bisphosphate carboxylase large chain OS=Barbarea verna OX=50458 GN=rbcL PE=3 SV=1) HSP 1 Score: 55.1 bits (131), Expect = 1.9e-07 Identity = 27/36 (75.00%), Postives = 30/36 (83.33%), Query Frame = 0
BLAST of MC07g0810 vs. ExPASy Swiss-Prot
Match: O99000 (Ribulose bisphosphate carboxylase large chain (Fragment) OS=Adenium obesum OX=69375 GN=rbcL PE=3 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 2.5e-07 Identity = 27/36 (75.00%), Postives = 30/36 (83.33%), Query Frame = 0
BLAST of MC07g0810 vs. ExPASy Swiss-Prot
Match: A4QJC3 (Ribulose bisphosphate carboxylase large chain OS=Aethionema cordifolium OX=434059 GN=rbcL PE=3 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 2.5e-07 Identity = 27/36 (75.00%), Postives = 30/36 (83.33%), Query Frame = 0
BLAST of MC07g0810 vs. ExPASy Swiss-Prot
Match: A4QJK7 (Ribulose bisphosphate carboxylase large chain OS=Aethionema grandiflorum OX=72657 GN=rbcL PE=3 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 2.5e-07 Identity = 27/36 (75.00%), Postives = 30/36 (83.33%), Query Frame = 0
BLAST of MC07g0810 vs. ExPASy Swiss-Prot
Match: Q05984 (Ribulose bisphosphate carboxylase large chain (Fragment) OS=Apocynum cannabinum OX=13339 GN=rbcL PE=3 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 2.5e-07 Identity = 27/36 (75.00%), Postives = 30/36 (83.33%), Query Frame = 0
BLAST of MC07g0810 vs. NCBI nr
Match: KAG4110354.1 (hypothetical protein ERO13_D13G043750v2 [Gossypium hirsutum]) HSP 1 Score: 60.1 bits (144), Expect = 3.47e-10 Identity = 28/36 (77.78%), Postives = 31/36 (86.11%), Query Frame = 0
BLAST of MC07g0810 vs. NCBI nr
Match: TYI45611.1 (hypothetical protein E1A91_D13G049700v1 [Gossypium mustelinum]) HSP 1 Score: 60.1 bits (144), Expect = 3.97e-10 Identity = 28/36 (77.78%), Postives = 31/36 (86.11%), Query Frame = 0
BLAST of MC07g0810 vs. NCBI nr
Match: XP_040965728.1 (ribulose bisphosphate carboxylase large chain-like [Gossypium hirsutum]) HSP 1 Score: 60.1 bits (144), Expect = 9.67e-10 Identity = 28/36 (77.78%), Postives = 31/36 (86.11%), Query Frame = 0
BLAST of MC07g0810 vs. NCBI nr
Match: PHT38114.1 (Ribulose bisphosphate carboxylase large chain [Capsicum baccatum]) HSP 1 Score: 57.4 bits (137), Expect = 5.26e-09 Identity = 27/36 (75.00%), Postives = 31/36 (86.11%), Query Frame = 0
BLAST of MC07g0810 vs. NCBI nr
Match: ACJ02943.1 (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial [Chuquiraga erinacea]) HSP 1 Score: 59.3 bits (142), Expect = 8.99e-09 Identity = 28/36 (77.78%), Postives = 31/36 (86.11%), Query Frame = 0
BLAST of MC07g0810 vs. ExPASy TrEMBL
Match: A0A5D2RXX6 (RuBisCO_large domain-containing protein OS=Gossypium mustelinum OX=34275 GN=E1A91_D13G049700v1 PE=4 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 1.92e-10 Identity = 28/36 (77.78%), Postives = 31/36 (86.11%), Query Frame = 0
BLAST of MC07g0810 vs. ExPASy TrEMBL
Match: A0A2G2VYP4 (Ribulose bisphosphate carboxylase large chain OS=Capsicum baccatum OX=33114 GN=CQW23_21687 PE=4 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 2.54e-09 Identity = 27/36 (75.00%), Postives = 31/36 (86.11%), Query Frame = 0
BLAST of MC07g0810 vs. ExPASy TrEMBL
Match: C4MXJ7 (Ribulose bisphosphate carboxylase large chain (Fragment) OS=Chuquiraga erinacea OX=171762 GN=rbcL PE=3 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 4.35e-09 Identity = 28/36 (77.78%), Postives = 31/36 (86.11%), Query Frame = 0
BLAST of MC07g0810 vs. ExPASy TrEMBL
Match: A0A0D2S8G2 (RuBisCO_large domain-containing protein (Fragment) OS=Gossypium raimondii OX=29730 GN=B456_013G048600 PE=4 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 4.87e-09 Identity = 27/36 (75.00%), Postives = 30/36 (83.33%), Query Frame = 0
BLAST of MC07g0810 vs. ExPASy TrEMBL
Match: I2EA07 (Ribulose bisphosphate carboxylase large chain (Fragment) OS=Helicostylis pedunculata OX=241885 GN=rbcl PE=3 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 8.14e-09 Identity = 28/36 (77.78%), Postives = 31/36 (86.11%), Query Frame = 0
BLAST of MC07g0810 vs. TAIR 10
Match: ATCG00490.1 (ribulose-bisphosphate carboxylases ) HSP 1 Score: 54.7 bits (130), Expect = 1.8e-08 Identity = 27/36 (75.00%), Postives = 30/36 (83.33%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (Dali-11) v1
Date Performed: 2021-10-25 Position : 0 Zoom : x 1
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|