![](http://cucurbitgenomics.org/sites/default/files/styles/slideshow/public/carousel/101322_web.jpg?itok=EG-G51x6)
MC05g1035 (gene) Bitter gourd (Dali-11) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.CAGACTGATCTTCTCGTTGTCGCATCCAAGACCCGAAAAATTATAAATATTAAGAAAGACCAGTTTTGTGCTCCATCTGTGAGTGAA CAGACTGATCTTCTCGTTGTCGCATCCAAGACCCGAAAAATTATAAATATTAAGAAAGACCAGTTTTGTGCTCCATCTGTGAGTGAA CAGACTGATCTTCTCGTTGTCGCATCCAAGACCCGAAAAATTATAAATATTAAGAAAGACCAGTTTTGTGCTCCATCTGTGAGTGAA QTDLLVVASKTRKIINIKKDQFCAPSVSE Homology
BLAST of MC05g1035 vs. ExPASy Swiss-Prot
Match: Q9AV97 (2-dehydro-3-deoxyphosphooctonate aldolase 1 OS=Arabidopsis thaliana OX=3702 GN=KDSA1 PE=1 SV=2) HSP 1 Score: 47.8 bits (112), Expect = 2.5e-05 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MC05g1035 vs. ExPASy Swiss-Prot
Match: O50044 (2-dehydro-3-deoxyphosphooctonate aldolase OS=Pisum sativum OX=3888 GN=KDSA PE=2 SV=1) HSP 1 Score: 47.8 bits (112), Expect = 2.5e-05 Identity = 23/27 (85.19%), Postives = 24/27 (88.89%), Query Frame = 0
BLAST of MC05g1035 vs. NCBI nr
Match: CAD61334.1 (3-deoxy-D-manno-2-octulosonic acid-8-phosphate, partial [Nicotiana tabacum]) HSP 1 Score: 48.9 bits (115), Expect = 1.79e-05 Identity = 24/29 (82.76%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MC05g1035 vs. NCBI nr
Match: MCI07647.1 (peroxisomal (S)-2-hydroxy-acid oxidase-like [Trifolium medium]) HSP 1 Score: 47.4 bits (111), Expect = 2.00e-05 Identity = 23/27 (85.19%), Postives = 24/27 (88.89%), Query Frame = 0
BLAST of MC05g1035 vs. NCBI nr
Match: XP_009800674.1 (PREDICTED: 2-dehydro-3-deoxyphosphooctonate aldolase 1-like [Nicotiana sylvestris]) HSP 1 Score: 48.9 bits (115), Expect = 2.63e-05 Identity = 24/29 (82.76%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MC05g1035 vs. NCBI nr
Match: XP_038717776.1 (2-dehydro-3-deoxyphosphooctonate aldolase 1 isoform X5 [Tripterygium wilfordii]) HSP 1 Score: 48.9 bits (115), Expect = 2.86e-05 Identity = 24/29 (82.76%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MC05g1035 vs. NCBI nr
Match: XP_038717773.1 (2-dehydro-3-deoxyphosphooctonate aldolase 1 isoform X2 [Tripterygium wilfordii]) HSP 1 Score: 48.9 bits (115), Expect = 2.96e-05 Identity = 24/29 (82.76%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MC05g1035 vs. ExPASy TrEMBL
Match: Q7XZC8 (3-deoxy-8-phosphooctulonate synthase (Fragment) OS=Nicotiana tabacum OX=4097 GN=kdsA PE=2 SV=1) HSP 1 Score: 48.9 bits (115), Expect = 8.69e-06 Identity = 24/29 (82.76%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MC05g1035 vs. ExPASy TrEMBL
Match: A0A392P6K6 (3-deoxy-8-phosphooctulonate synthase (Fragment) OS=Trifolium medium OX=97028 GN=A2U01_0028716 PE=3 SV=1) HSP 1 Score: 47.4 bits (111), Expect = 9.69e-06 Identity = 23/27 (85.19%), Postives = 24/27 (88.89%), Query Frame = 0
BLAST of MC05g1035 vs. ExPASy TrEMBL
Match: A0A1U7YN55 (3-deoxy-8-phosphooctulonate synthase OS=Nicotiana sylvestris OX=4096 GN=LOC104246560 PE=3 SV=1) HSP 1 Score: 48.9 bits (115), Expect = 1.27e-05 Identity = 24/29 (82.76%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MC05g1035 vs. ExPASy TrEMBL
Match: A0A7J7D082 (3-deoxy-8-phosphooctulonate synthase OS=Tripterygium wilfordii OX=458696 GN=HS088_TW12G00967 PE=3 SV=1) HSP 1 Score: 48.9 bits (115), Expect = 1.43e-05 Identity = 24/29 (82.76%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MC05g1035 vs. ExPASy TrEMBL
Match: A0A1S4CUN3 (3-deoxy-8-phosphooctulonate synthase OS=Nicotiana tabacum OX=4097 GN=LOC107822777 PE=3 SV=1) HSP 1 Score: 48.9 bits (115), Expect = 1.43e-05 Identity = 24/29 (82.76%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MC05g1035 vs. TAIR 10
Match: AT1G79500.1 (Aldolase-type TIM barrel family protein ) HSP 1 Score: 47.8 bits (112), Expect = 1.8e-06 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MC05g1035 vs. TAIR 10
Match: AT1G79500.2 (Aldolase-type TIM barrel family protein ) HSP 1 Score: 47.8 bits (112), Expect = 1.8e-06 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MC05g1035 vs. TAIR 10
Match: AT1G79500.3 (Aldolase-type TIM barrel family protein ) HSP 1 Score: 47.8 bits (112), Expect = 1.8e-06 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MC05g1035 vs. TAIR 10
Match: AT1G79500.4 (Aldolase-type TIM barrel family protein ) HSP 1 Score: 47.8 bits (112), Expect = 1.8e-06 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 0
BLAST of MC05g1035 vs. TAIR 10
Match: AT1G79500.5 (Aldolase-type TIM barrel family protein ) HSP 1 Score: 47.8 bits (112), Expect = 1.8e-06 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (Dali-11) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|