MC02g1216 (gene) Bitter gourd (Dali-11) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.TTAGGTTCTTTAAATTCCGTGGATGGCATAGCTACTGAAATTAATGCAATCAATTATGTCTCTTCTAGAAGTTGGTTAGCTACCTCTCATTTTGTTCTAGGATTC TTAGGTTCTTTAAATTCCGTGGATGGCATAGCTACTGAAATTAATGCAATCAATTATGTCTCTTCTAGAAGTTGGTTAGCTACCTCTCATTTTGTTCTAGGATTC TTAGGTTCTTTAAATTCCGTGGATGGCATAGCTACTGAAATTAATGCAATCAATTATGTCTCTTCTAGAAGTTGGTTAGCTACCTCTCATTTTGTTCTAGGATTC LGSLNSVDGIATEINAINYVSSRSWLATSHFVLGF Homology
BLAST of MC02g1216 vs. ExPASy Swiss-Prot
Match: A9LYI1 (Photosystem II CP43 reaction center protein OS=Acorus americanus OX=263995 GN=psbC PE=3 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 6.3e-11 Identity = 31/35 (88.57%), Postives = 33/35 (94.29%), Query Frame = 0
BLAST of MC02g1216 vs. ExPASy Swiss-Prot
Match: Q3V538 (Photosystem II CP43 reaction center protein OS=Acorus calamus OX=4465 GN=psbC PE=3 SV=2) HSP 1 Score: 66.6 bits (161), Expect = 6.3e-11 Identity = 31/35 (88.57%), Postives = 33/35 (94.29%), Query Frame = 0
BLAST of MC02g1216 vs. ExPASy Swiss-Prot
Match: Q85FM3 (Photosystem II CP43 reaction center protein OS=Adiantum capillus-veneris OX=13818 GN=psbC PE=2 SV=3) HSP 1 Score: 66.6 bits (161), Expect = 6.3e-11 Identity = 31/35 (88.57%), Postives = 33/35 (94.29%), Query Frame = 0
BLAST of MC02g1216 vs. ExPASy Swiss-Prot
Match: Q70Y07 (Photosystem II CP43 reaction center protein OS=Amborella trichopoda OX=13333 GN=psbC PE=3 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 6.3e-11 Identity = 31/35 (88.57%), Postives = 33/35 (94.29%), Query Frame = 0
BLAST of MC02g1216 vs. ExPASy Swiss-Prot
Match: Q85AU0 (Photosystem II CP43 reaction center protein OS=Anthoceros angustus OX=48387 GN=psbC PE=2 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 6.3e-11 Identity = 31/35 (88.57%), Postives = 33/35 (94.29%), Query Frame = 0
BLAST of MC02g1216 vs. NCBI nr
Match: TYJ27193.1 (hypothetical protein E1A91_A07G169800v1 [Gossypium mustelinum]) HSP 1 Score: 69.7 bits (169), Expect = 2.46e-14 Identity = 31/35 (88.57%), Postives = 34/35 (97.14%), Query Frame = 0
BLAST of MC02g1216 vs. NCBI nr
Match: MBA0753695.1 (hypothetical protein [Gossypium gossypioides] >MBA0753697.1 hypothetical protein [Gossypium gossypioides]) HSP 1 Score: 68.2 bits (165), Expect = 7.58e-14 Identity = 32/35 (91.43%), Postives = 34/35 (97.14%), Query Frame = 0
BLAST of MC02g1216 vs. NCBI nr
Match: AET02870.1 (photosystem II CP43 chlorophyll apoprotein [Medicago truncatula]) HSP 1 Score: 67.0 bits (162), Expect = 2.02e-13 Identity = 31/35 (88.57%), Postives = 33/35 (94.29%), Query Frame = 0
BLAST of MC02g1216 vs. NCBI nr
Match: RZC90399.1 (hypothetical protein C5167_041351 [Papaver somniferum]) HSP 1 Score: 67.4 bits (163), Expect = 2.02e-13 Identity = 31/35 (88.57%), Postives = 33/35 (94.29%), Query Frame = 0
BLAST of MC02g1216 vs. NCBI nr
Match: KAG0540647.1 (hypothetical protein BDA96_03G426800 [Sorghum bicolor] >KXG33956.1 hypothetical protein SORBI_3003G395800 [Sorghum bicolor]) HSP 1 Score: 67.4 bits (163), Expect = 2.02e-13 Identity = 31/35 (88.57%), Postives = 33/35 (94.29%), Query Frame = 0
BLAST of MC02g1216 vs. ExPASy TrEMBL
Match: A0A5D2YM11 (Uncharacterized protein OS=Gossypium mustelinum OX=34275 GN=E1A91_A07G169800v1 PE=4 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 1.19e-14 Identity = 31/35 (88.57%), Postives = 34/35 (97.14%), Query Frame = 0
BLAST of MC02g1216 vs. ExPASy TrEMBL
Match: A0A7J9CZI3 (Uncharacterized protein OS=Gossypium gossypioides OX=34282 GN=Gogos_021964 PE=4 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 3.67e-14 Identity = 32/35 (91.43%), Postives = 34/35 (97.14%), Query Frame = 0
BLAST of MC02g1216 vs. ExPASy TrEMBL
Match: G7LB05 (Photosystem II CP43 chlorophyll apoprotein OS=Medicago truncatula OX=3880 GN=MTR_8g056790 PE=4 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 9.77e-14 Identity = 31/35 (88.57%), Postives = 33/35 (94.29%), Query Frame = 0
BLAST of MC02g1216 vs. ExPASy TrEMBL
Match: A0A1B6Q7R5 (Uncharacterized protein OS=Sorghum bicolor OX=4558 GN=SORBI_3003G395800 PE=4 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 9.77e-14 Identity = 31/35 (88.57%), Postives = 33/35 (94.29%), Query Frame = 0
BLAST of MC02g1216 vs. ExPASy TrEMBL
Match: A0A444ZGJ8 (Uncharacterized protein OS=Arachis hypogaea OX=3818 GN=Ahy_B04g070372 PE=4 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.25e-13 Identity = 31/35 (88.57%), Postives = 33/35 (94.29%), Query Frame = 0
BLAST of MC02g1216 vs. TAIR 10
Match: ATCG00280.1 (photosystem II reaction center protein C ) HSP 1 Score: 65.5 bits (158), Expect = 9.9e-12 Identity = 30/35 (85.71%), Postives = 33/35 (94.29%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (Dali-11) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|