![](http://cucurbitgenomics.org/sites/default/files/styles/slideshow/public/carousel/101322_web.jpg?itok=EG-G51x6)
MC00g0467 (gene) Bitter gourd (Dali-11) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: CDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.GAATGCGCGATTTGTTTGGGGGAATTTGAAATTGGCGACGATTTGAGGATTTTGCCCAATTGCAGCCATGGATTCCATGTGAATTGTATCGATCATTGGTTCGTCTCCCACTCTTCGTGCCCTAATTGCCGGCATTCTCTGCTG GAATGCGCGATTTGTTTGGGGGAATTTGAAATTGGCGACGATTTGAGGATTTTGCCCAATTGCAGCCATGGATTCCATGTGAATTGTATCGATCATTGGTTCGTCTCCCACTCTTCGTGCCCTAATTGCCGGCATTCTCTGCTG GAATGCGCGATTTGTTTGGGGGAATTTGAAATTGGCGACGATTTGAGGATTTTGCCCAATTGCAGCCATGGATTCCATGTGAATTGTATCGATCATTGGTTCGTCTCCCACTCTTCGTGCCCTAATTGCCGGCATTCTCTGCTG ECAICLGEFEIGDDLRILPNCSHGFHVNCIDHWFVSHSSCPNCRHSLL Homology
BLAST of MC00g0467 vs. ExPASy Swiss-Prot
Match: Q9LZV8 (RING-H2 finger protein ATL74 OS=Arabidopsis thaliana OX=3702 GN=ATL74 PE=2 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 3.6e-17 Identity = 34/48 (70.83%), Postives = 41/48 (85.42%), Query Frame = 0
BLAST of MC00g0467 vs. ExPASy Swiss-Prot
Match: Q9LM69 (RING-H2 finger protein ATL80 OS=Arabidopsis thaliana OX=3702 GN=ATL80 PE=2 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 8.9e-16 Identity = 33/48 (68.75%), Postives = 37/48 (77.08%), Query Frame = 0
BLAST of MC00g0467 vs. ExPASy Swiss-Prot
Match: Q8LC69 (RING-H2 finger protein ATL8 OS=Arabidopsis thaliana OX=3702 GN=ATL8 PE=2 SV=2) HSP 1 Score: 83.2 bits (204), Expect = 8.9e-16 Identity = 33/48 (68.75%), Postives = 38/48 (79.17%), Query Frame = 0
BLAST of MC00g0467 vs. ExPASy Swiss-Prot
Match: Q9FLC6 (RING-H2 finger protein ATL73 OS=Arabidopsis thaliana OX=3702 GN=ATL73 PE=2 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 1.2e-15 Identity = 32/48 (66.67%), Postives = 38/48 (79.17%), Query Frame = 0
BLAST of MC00g0467 vs. ExPASy Swiss-Prot
Match: Q9SG96 (RING-H2 finger protein ATL72 OS=Arabidopsis thaliana OX=3702 GN=ATL72 PE=2 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 1.5e-15 Identity = 32/48 (66.67%), Postives = 38/48 (79.17%), Query Frame = 0
BLAST of MC00g0467 vs. NCBI nr
Match: XP_022144089.1 (RING-H2 finger protein ATL74-like [Momordica charantia]) HSP 1 Score: 113 bits (283), Expect = 3.00e-30 Identity = 48/48 (100.00%), Postives = 48/48 (100.00%), Query Frame = 0
BLAST of MC00g0467 vs. NCBI nr
Match: XP_022930638.1 (RING-H2 finger protein ATL74-like [Cucurbita moschata] >KAG6596310.1 RING-H2 finger protein ATL72, partial [Cucurbita argyrosperma subsp. sororia] >KAG7027864.1 RING-H2 finger protein ATL72, partial [Cucurbita argyrosperma subsp. argyrosperma]) HSP 1 Score: 96.3 bits (238), Expect = 2.67e-23 Identity = 38/48 (79.17%), Postives = 44/48 (91.67%), Query Frame = 0
BLAST of MC00g0467 vs. NCBI nr
Match: KAA0025403.1 (RING-H2 finger protein ATL74 [Cucumis melo var. makuwa]) HSP 1 Score: 95.5 bits (236), Expect = 3.37e-23 Identity = 39/47 (82.98%), Postives = 43/47 (91.49%), Query Frame = 0
BLAST of MC00g0467 vs. NCBI nr
Match: XP_008463261.1 (PREDICTED: RING-H2 finger protein ATL74 [Cucumis melo] >TYK09770.1 RING-H2 finger protein ATL74 [Cucumis melo var. makuwa]) HSP 1 Score: 95.5 bits (236), Expect = 3.37e-23 Identity = 39/47 (82.98%), Postives = 43/47 (91.49%), Query Frame = 0
BLAST of MC00g0467 vs. NCBI nr
Match: XP_011653722.1 (RING-H2 finger protein ATL74 isoform X1 [Cucumis sativus] >KGN54449.1 hypothetical protein Csa_012932 [Cucumis sativus]) HSP 1 Score: 93.2 bits (230), Expect = 3.29e-22 Identity = 38/47 (80.85%), Postives = 42/47 (89.36%), Query Frame = 0
BLAST of MC00g0467 vs. ExPASy TrEMBL
Match: A0A6J1CR99 (RING-H2 finger protein ATL74-like OS=Momordica charantia OX=3673 GN=LOC111013867 PE=4 SV=1) HSP 1 Score: 113 bits (283), Expect = 1.45e-30 Identity = 48/48 (100.00%), Postives = 48/48 (100.00%), Query Frame = 0
BLAST of MC00g0467 vs. ExPASy TrEMBL
Match: A0A6J1EVU3 (RING-H2 finger protein ATL74-like OS=Cucurbita moschata OX=3662 GN=LOC111437007 PE=4 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.29e-23 Identity = 38/48 (79.17%), Postives = 44/48 (91.67%), Query Frame = 0
BLAST of MC00g0467 vs. ExPASy TrEMBL
Match: A0A5A7SL64 (RING-H2 finger protein ATL74 OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold1220G00400 PE=4 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 1.63e-23 Identity = 39/47 (82.98%), Postives = 43/47 (91.49%), Query Frame = 0
BLAST of MC00g0467 vs. ExPASy TrEMBL
Match: A0A5D3CEJ5 (RING-H2 finger protein ATL74 OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold127G00540 PE=4 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 1.63e-23 Identity = 39/47 (82.98%), Postives = 43/47 (91.49%), Query Frame = 0
BLAST of MC00g0467 vs. ExPASy TrEMBL
Match: A0A1S3CKD5 (RING-H2 finger protein ATL74 OS=Cucumis melo OX=3656 GN=LOC103501464 PE=4 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 1.63e-23 Identity = 39/47 (82.98%), Postives = 43/47 (91.49%), Query Frame = 0
BLAST of MC00g0467 vs. TAIR 10
Match: AT5G01880.1 (RING/U-box superfamily protein ) HSP 1 Score: 87.8 bits (216), Expect = 2.6e-18 Identity = 34/48 (70.83%), Postives = 41/48 (85.42%), Query Frame = 0
BLAST of MC00g0467 vs. TAIR 10
Match: AT1G20823.1 (RING/U-box superfamily protein ) HSP 1 Score: 83.2 bits (204), Expect = 6.3e-17 Identity = 33/48 (68.75%), Postives = 37/48 (77.08%), Query Frame = 0
BLAST of MC00g0467 vs. TAIR 10
Match: AT1G76410.1 (RING/U-box superfamily protein ) HSP 1 Score: 83.2 bits (204), Expect = 6.3e-17 Identity = 33/48 (68.75%), Postives = 38/48 (79.17%), Query Frame = 0
BLAST of MC00g0467 vs. TAIR 10
Match: AT5G05280.1 (RING/U-box superfamily protein ) HSP 1 Score: 82.8 bits (203), Expect = 8.2e-17 Identity = 32/48 (66.67%), Postives = 38/48 (79.17%), Query Frame = 0
BLAST of MC00g0467 vs. TAIR 10
Match: AT3G10910.1 (RING/U-box superfamily protein ) HSP 1 Score: 82.4 bits (202), Expect = 1.1e-16 Identity = 32/48 (66.67%), Postives = 38/48 (79.17%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Bitter gourd (Dali-11) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|