IVF0009877 (gene) Melon (IVF77) v1
Overview
Sequences
The following sequences are available for this feature:
Legend: exonCDSpolypeptide Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTCCTCAAGTATCAGTTAGTTCTTGAAGATCTTGATGTTTTGGTCTCTGTAAGGTCTGATGAGGATTTAAAGCATAGGCTCGATGAGTATGATTACCTAGAAAGTGAAGGAAAGCTTCAATGTTTCTTTTTTCCTTCAAATCCAATTTTCATTAAGGCTCAGCCATTCTCCTCAAATCCCCAGCAAATCGAGCAACGTTATTTTGAAGCTATCAATGGCATTGTATGGTCTGGCTCCTTTGCCAATGTAAAACTTTCTCGTAGTACCGCTAACTGA ATGGTCCTCAAGTATCAGTTAGTTCTTGAAGATCTTGATGTTTTGGTCTCTGTAAGGTCTGATGAGGATTTAAAGCATAGGCTCGATGAGTATGATTACCTAGAAAGTGAAGGAAAGCTTCAATGTTTCTTTTTTCCTTCAAATCCAATTTTCATTAAGGCTCAGCCATTCTCCTCAAATCCCCAGCAAATCGAGCAACGTTATTTTGAAGCTATCAATGGCATTGTATGGTCTGGCTCCTTTGCCAATGTAAAACTTTCTCGTAGTACCGCTAACTGA ATGGTCCTCAAGTATCAGTTAGTTCTTGAAGATCTTGATGTTTTGGTCTCTGTAAGGTCTGATGAGGATTTAAAGCATAGGCTCGATGAGTATGATTACCTAGAAAGTGAAGGAAAGCTTCAATGTTTCTTTTTTCCTTCAAATCCAATTTTCATTAAGGCTCAGCCATTCTCCTCAAATCCCCAGCAAATCGAGCAACGTTATTTTGAAGCTATCAATGGCATTGTATGGTCTGGCTCCTTTGCCAATGTAAAACTTTCTCGTAGTACCGCTAACTGA MVLKYQLVLEDLDVLVSVRSDEDLKHRLDEYDYLESEGKLQCFFFPSNPIFIKAQPFSSNPQQIEQRYFEAINGIVWSGSFANVKLSRSTAN Homology
BLAST of IVF0009877 vs. ExPASy TrEMBL
Match: A0A5D3E246 (Octicosapeptide/Phox/Bem1p domain-containing family protein OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold588G00090 PE=4 SV=1) HSP 1 Score: 180.6 bits (457), Expect = 2.9e-42 Identity = 90/92 (97.83%), Postives = 90/92 (97.83%), Query Frame = 0
BLAST of IVF0009877 vs. ExPASy TrEMBL
Match: A0A5A7UL31 (Octicosapeptide/Phox/Bem1p domain-containing family protein OS=Cucumis melo var. makuwa OX=1194695 GN=E5676_scaffold106G00210 PE=4 SV=1) HSP 1 Score: 174.9 bits (442), Expect = 1.6e-40 Identity = 86/92 (93.48%), Postives = 88/92 (95.65%), Query Frame = 0
BLAST of IVF0009877 vs. ExPASy TrEMBL
Match: A0A5A7U7T5 (PB1 domain-containing protein OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold60G002390 PE=4 SV=1) HSP 1 Score: 174.5 bits (441), Expect = 2.1e-40 Identity = 87/92 (94.57%), Postives = 88/92 (95.65%), Query Frame = 0
BLAST of IVF0009877 vs. ExPASy TrEMBL
Match: A0A5A7T2V3 (Octicosapeptide/Phox/Bem1p domain-containing family protein OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold918G00140 PE=4 SV=1) HSP 1 Score: 165.2 bits (417), Expect = 1.3e-37 Identity = 86/92 (93.48%), Postives = 86/92 (93.48%), Query Frame = 0
BLAST of IVF0009877 vs. ExPASy TrEMBL
Match: A0A5A7T3H0 (Tub domain-containing protein OS=Cucumis melo var. makuwa OX=1194695 GN=E6C27_scaffold36G00470 PE=3 SV=1) HSP 1 Score: 146.7 bits (369), Expect = 4.6e-32 Identity = 70/75 (93.33%), Postives = 72/75 (96.00%), Query Frame = 0
BLAST of IVF0009877 vs. NCBI nr
Match: KAA0053093.1 (octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa] >KAA0065720.1 octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa] >TYK29946.1 octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa]) HSP 1 Score: 179 bits (455), Expect = 9.81e-57 Identity = 90/92 (97.83%), Postives = 90/92 (97.83%), Query Frame = 0
BLAST of IVF0009877 vs. NCBI nr
Match: KAA0056522.1 (octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa] >TYK12092.1 octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa]) HSP 1 Score: 174 bits (440), Expect = 1.91e-54 Identity = 86/92 (93.48%), Postives = 88/92 (95.65%), Query Frame = 0
BLAST of IVF0009877 vs. NCBI nr
Match: KAA0051822.1 (hypothetical protein E6C27_scaffold60G002390 [Cucumis melo var. makuwa]) HSP 1 Score: 173 bits (439), Expect = 2.71e-54 Identity = 87/92 (94.57%), Postives = 88/92 (95.65%), Query Frame = 0
BLAST of IVF0009877 vs. NCBI nr
Match: KAA0037802.1 (octicosapeptide/Phox/Bem1p domain-containing family protein [Cucumis melo var. makuwa]) HSP 1 Score: 164 bits (415), Expect = 1.24e-50 Identity = 86/92 (93.48%), Postives = 86/92 (93.48%), Query Frame = 0
BLAST of IVF0009877 vs. NCBI nr
Match: KAA0037880.1 (uncharacterized protein E6C27_scaffold36G00470 [Cucumis melo var. makuwa]) HSP 1 Score: 146 bits (369), Expect = 1.63e-42 Identity = 70/75 (93.33%), Postives = 72/75 (96.00%), Query Frame = 0
BLAST of IVF0009877 vs. TAIR 10
Match: AT5G49920.1 (Octicosapeptide/Phox/Bem1p family protein ) HSP 1 Score: 87.0 bits (214), Expect = 8.4e-18 Identity = 43/76 (56.58%), Postives = 59/76 (77.63%), Query Frame = 0
BLAST of IVF0009877 vs. TAIR 10
Match: AT1G79570.1 (Protein kinase superfamily protein with octicosapeptide/Phox/Bem1p domain ) HSP 1 Score: 54.7 bits (130), Expect = 4.6e-08 Identity = 38/96 (39.58%), Postives = 57/96 (59.38%), Query Frame = 0
BLAST of IVF0009877 vs. TAIR 10
Match: AT3G46920.1 (Protein kinase superfamily protein with octicosapeptide/Phox/Bem1p domain ) HSP 1 Score: 51.2 bits (121), Expect = 5.1e-07 Identity = 34/87 (39.08%), Postives = 50/87 (57.47%), Query Frame = 0
BLAST of IVF0009877 vs. TAIR 10
Match: AT5G09620.1 (Octicosapeptide/Phox/Bem1p family protein ) HSP 1 Score: 51.2 bits (121), Expect = 5.1e-07 Identity = 26/51 (50.98%), Postives = 34/51 (66.67%), Query Frame = 0
BLAST of IVF0009877 vs. TAIR 10
Match: AT5G64430.1 (Octicosapeptide/Phox/Bem1p family protein ) HSP 1 Score: 50.1 bits (118), Expect = 1.1e-06 Identity = 29/79 (36.71%), Postives = 44/79 (55.70%), Query Frame = 0
The following BLAST results are available for this feature:
InterPro
Analysis Name: InterPro Annotations of Melon (IVF77) v1
Date Performed: 2021-10-25
Relationships
The following mRNA feature(s) are a part of this gene:
GO Annotation
GO Assignments
This gene is annotated with the following GO terms.
|